EMAIL THIS PAGE TO A FRIEND

TMEM128

transmembrane protein 128

UniProtKB ID: Q5BJH2, B4DHS7, D3DVS3, Q5H9U6, Q96I94
Gene ID:
Mouse(66309) transmembrane protein 128
Rat(360952) transmembrane protein 128
cow(513824) transmembrane protein 128
sheep(101104152) transmembrane protein 128
naked mole-rat(101703824) transmembrane protein 128
domestic guinea pig(100728027) transmembrane protein 128
Zebrafish(574426) transmembrane protein 128
chicken(422845) transmembrane protein 128
dog(479094) transmembrane protein 128
domestic cat(101089104) transmembrane protein 128
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032927 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032927 Rosetta Predictions human pricing
NM_001108362 Rosetta Predictions rat pricing
NM_025480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160655 predicted 766
2 SASI_Hs01_00160656 predicted 773
3 SASI_Hs01_00160658 predicted 1401
4 SASI_Hs01_00160659 predicted 761
5 SASI_Hs01_00160660 predicted 760
6 SASI_Hs01_00160661 predicted 1400
7 SASI_Hs01_00160662 predicted 776
8 SASI_Hs01_00160664 predicted 730
9 SASI_Hs01_00160657 predicted 1328
10 SASI_Hs02_00360538 predicted 772
11 SASI_Hs01_00160663 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237919 predicted 501
2 SASI_Rn02_00237920 predicted 711
3 SASI_Rn02_00237921 predicted 591
4 SASI_Rn02_00237922 predicted 404
5 SASI_Rn02_00237923 predicted 221
6 SASI_Rn02_00237924 predicted 574
7 SASI_Rn02_00237925 predicted 823
8 SASI_Rn02_00237926 predicted 434
9 SASI_Rn02_00237927 predicted 704
10 SASI_Rn02_00237928 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104059 predicted 512
2 SASI_Mm01_00104060 predicted 700
3 SASI_Mm01_00104061 predicted 396
4 SASI_Mm01_00104062 predicted 643
5 SASI_Mm01_00104065 predicted 812
6 SASI_Mm01_00104066 predicted 208
7 SASI_Mm01_00104067 predicted 521
8 SASI_Mm01_00104068 predicted 769
9 SASI_Mm02_00328349 predicted 520
10 SASI_Mm02_00328350 predicted 526
11 SASI_Mm01_00104063 predicted 250
12 SASI_Mm01_00104064 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025480
VALIDATED
TMEM128 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 128
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-655s21c1
Sequence:CCGGGCTGTCGAAATCAGAATAAATCTCGAGATTTATTCTGATTTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-196s21c1
Sequence:CCGGTCCATCGTTGTGACCTATTATCTCGAGATAATAGGTCACAACGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-151s21c1
Sequence:CCGGCCTCTTCCAAGACTTAACATTCTCGAGAATGTTAAGTCTTGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025480.3-271s21c1
Sequence:CCGGTTTGGCGGAGCCTTGTTATTTCTCGAGAAATAACAAGGCTCCGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-499s21c1
Sequence:CCGGTTCATCTCACTCCTCGGATAACTCGAGTTATCCGAGGAGTGAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-152s1c1
Sequence:CCGGCCTCTTCCAAGACTTAACATTCTCGAGAATGTTAAGTCTTGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-197s1c1
Sequence:CCGGTCCATCGTTGTGACCTATTATCTCGAGATAATAGGTCACAACGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-194s1c1
Sequence:CCGGGCATCCATCGTTGTGACCTATCTCGAGATAGGTCACAACGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-341s1c1
Sequence:CCGGCGTGGGATTGAAGAATATGATCTCGAGATCATATTCTTCAATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-656s1c1
Sequence:CCGGGCTGTCGAAATCAGAATAAATCTCGAGATTTATTCTGATTTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025480
VALIDATED
TMEM128 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 128
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-655s21c1
Sequence:CCGGGCTGTCGAAATCAGAATAAATCTCGAGATTTATTCTGATTTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-196s21c1
Sequence:CCGGTCCATCGTTGTGACCTATTATCTCGAGATAATAGGTCACAACGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-151s21c1
Sequence:CCGGCCTCTTCCAAGACTTAACATTCTCGAGAATGTTAAGTCTTGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025480.3-271s21c1
Sequence:CCGGTTTGGCGGAGCCTTGTTATTTCTCGAGAAATAACAAGGCTCCGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-499s21c1
Sequence:CCGGTTCATCTCACTCCTCGGATAACTCGAGTTATCCGAGGAGTGAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-152s1c1
Sequence:CCGGCCTCTTCCAAGACTTAACATTCTCGAGAATGTTAAGTCTTGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-197s1c1
Sequence:CCGGTCCATCGTTGTGACCTATTATCTCGAGATAATAGGTCACAACGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-194s1c1
Sequence:CCGGGCATCCATCGTTGTGACCTATCTCGAGATAGGTCACAACGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-341s1c1
Sequence:CCGGCGTGGGATTGAAGAATATGATCTCGAGATCATATTCTTCAATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-656s1c1
Sequence:CCGGGCTGTCGAAATCAGAATAAATCTCGAGATTTATTCTGATTTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025480
VALIDATED
TMEM128 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 128
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-655s21c1
Sequence:CCGGGCTGTCGAAATCAGAATAAATCTCGAGATTTATTCTGATTTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-196s21c1
Sequence:CCGGTCCATCGTTGTGACCTATTATCTCGAGATAATAGGTCACAACGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-151s21c1
Sequence:CCGGCCTCTTCCAAGACTTAACATTCTCGAGAATGTTAAGTCTTGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025480.3-271s21c1
Sequence:CCGGTTTGGCGGAGCCTTGTTATTTCTCGAGAAATAACAAGGCTCCGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025480.3-499s21c1
Sequence:CCGGTTCATCTCACTCCTCGGATAACTCGAGTTATCCGAGGAGTGAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-152s1c1
Sequence:CCGGCCTCTTCCAAGACTTAACATTCTCGAGAATGTTAAGTCTTGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-197s1c1
Sequence:CCGGTCCATCGTTGTGACCTATTATCTCGAGATAATAGGTCACAACGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-194s1c1
Sequence:CCGGGCATCCATCGTTGTGACCTATCTCGAGATAGGTCACAACGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-341s1c1
Sequence:CCGGCGTGGGATTGAAGAATATGATCTCGAGATCATATTCTTCAATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025480.2-656s1c1
Sequence:CCGGGCTGTCGAAATCAGAATAAATCTCGAGATTTATTCTGATTTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032927
TMEM128 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 128
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-862s1c1
Sequence:CCGGGCCTTGATACCCATTACCACTCTCGAGAGTGGTAATGGGTATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-816s1c1
Sequence:CCGGCCTGGAATGGTATTGTGGAATCTCGAGATTCCACAATACCATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032927.2-1151s1c1
Sequence:CCGGGAATGGTTAAACATCCAGCTACTCGAGTAGCTGGATGTTTAACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032927.2-636s1c1
Sequence:CCGGGAAACCTCTTCCAAGACTTAACTCGAGTTAAGTCTTGGAAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-898s1c1
Sequence:CCGGGCAGGAATTTGCTTCAACATTCTCGAGAATGTTGAAGCAAATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032927.2-1379s1c1
Sequence:CCGGCTTTGGAGAAAGTGGTTTCATCTCGAGATGAAACCACTTTCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032927
TMEM128 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 128
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-862s1c1
Sequence:CCGGGCCTTGATACCCATTACCACTCTCGAGAGTGGTAATGGGTATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-816s1c1
Sequence:CCGGCCTGGAATGGTATTGTGGAATCTCGAGATTCCACAATACCATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032927.2-1151s1c1
Sequence:CCGGGAATGGTTAAACATCCAGCTACTCGAGTAGCTGGATGTTTAACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032927.2-636s1c1
Sequence:CCGGGAAACCTCTTCCAAGACTTAACTCGAGTTAAGTCTTGGAAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-898s1c1
Sequence:CCGGGCAGGAATTTGCTTCAACATTCTCGAGAATGTTGAAGCAAATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032927.2-1379s1c1
Sequence:CCGGCTTTGGAGAAAGTGGTTTCATCTCGAGATGAAACCACTTTCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032927
TMEM128 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 128
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-862s1c1
Sequence:CCGGGCCTTGATACCCATTACCACTCTCGAGAGTGGTAATGGGTATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-816s1c1
Sequence:CCGGCCTGGAATGGTATTGTGGAATCTCGAGATTCCACAATACCATTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032927.2-1151s1c1
Sequence:CCGGGAATGGTTAAACATCCAGCTACTCGAGTAGCTGGATGTTTAACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032927.2-636s1c1
Sequence:CCGGGAAACCTCTTCCAAGACTTAACTCGAGTTAAGTCTTGGAAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032927.2-898s1c1
Sequence:CCGGGCAGGAATTTGCTTCAACATTCTCGAGAATGTTGAAGCAAATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032927.2-1379s1c1
Sequence:CCGGCTTTGGAGAAAGTGGTTTCATCTCGAGATGAAACCACTTTCTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks