EMAIL THIS PAGE TO A FRIEND

TMEM129

transmembrane protein 129

Synonyms: D4S2561E
UniProtKB ID: A0AVI4, A6NH49, A6NI98, D3DVP8
Gene ID:
Mouse(68366) transmembrane protein 129
Rat(305458) transmembrane protein 129
Zebrafish(406756) transmembrane protein 129
chicken(422900) transmembrane protein 129
domestic cat(101095740) transmembrane protein 129
dog(608955) transmembrane protein 129
domestic guinea pig(100719977) transmembrane protein 129
naked mole-rat(101715795) transmembrane protein 129
cow(518991) transmembrane protein 129
sheep(101104403) transmembrane protein 129
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138385 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127266 Rosetta Predictions human pricing
NM_138385 Rosetta Predictions human pricing
NM_001126274 Rosetta Predictions rat pricing
NM_026698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329077 predicted 730
2 SASI_Hs02_00329078 predicted 1685
3 SASI_Hs02_00329079 predicted 1956
4 SASI_Hs02_00329080 predicted 955
5 SASI_Hs02_00329081 predicted 1703
6 SASI_Hs02_00329082 predicted 955
7 SASI_Hs02_00329083 predicted 1944
8 SASI_Hs02_00329084 predicted 966
9 SASI_Hs02_00329085 predicted 936
10 SASI_Hs02_00329086 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018636 predicted 730
2 SASI_Hs01_00018635 predicted 1521
3 SASI_Hs01_00018637 predicted 954
4 SASI_Hs01_00018639 predicted 1547
5 SASI_Hs01_00018640 predicted 953
6 SASI_Hs01_00018642 predicted 969
7 SASI_Hs02_00363522 predicted 935
8 SASI_Hs01_00018638 predicted 1015
9 SASI_Hs02_00363523 predicted 536
10 SASI_Hs02_00363524 predicted 1174
11 SASI_Hs01_00018634 predicted 1530
12 SASI_Hs01_00018641 predicted 843
13 SASI_Hs01_00018643 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253113 predicted 243
2 SASI_Rn02_00253114 predicted 737
3 SASI_Rn02_00253115 predicted 1378
4 SASI_Rn02_00253116 predicted 814
5 SASI_Rn02_00253117 predicted 1236
6 SASI_Rn02_00253118 predicted 1278
7 SASI_Rn02_00253119 predicted 1271
8 SASI_Rn02_00253120 predicted 921
9 SASI_Rn02_00253121 predicted 513
10 SASI_Rn02_00253122 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054606 predicted 1181
2 SASI_Mm01_00054607 predicted 1146
3 SASI_Mm01_00054608 predicted 666
4 SASI_Mm01_00054609 predicted 1157
5 SASI_Mm01_00054611 predicted 930
6 SASI_Mm01_00054612 predicted 337
7 SASI_Mm01_00054613 predicted 1092
8 SASI_Mm02_00330741 predicted 592
9 SASI_Mm01_00054614 predicted 439
10 SASI_Mm01_00054615 predicted 673
11 SASI_Mm01_00054610 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138385
VALIDATED
TMEM129 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 129
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138385.2-1807s1c1
Sequence:CCGGGCCTTACTTCTCTGGAGCATACTCGAGTATGCTCCAGAGAAGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138385.2-2161s1c1
Sequence:CCGGGTTGAGGACCAAAGTGCCATACTCGAGTATGGCACTTTGGTCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138385.2-843s1c1
Sequence:CCGGGCATCCTGATCTACTACTGGTCTCGAGACCAGTAGTAGATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138385.3-723s21c1
Sequence:CCGGTCGGCTACTATGTGGGCATGTCTCGAGACATGCCCACATAGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-1528s21c1
Sequence:CCGGCTGGCAAAGGGCTCTACTTAACTCGAGTTAAGTAGAGCCCTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-1025s21c1
Sequence:CCGGACGTGGGTGATGAAGGTAACCCTCGAGGGTTACCTTCATCACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-942s21c1
Sequence:CCGGTTGCCTCCTCTGTCAACACTGCTCGAGCAGTGTTGACAGAGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-837s21c1
Sequence:CCGGTCGCCTGCATCCTGATCTACTCTCGAGAGTAGATCAGGATGCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138385
VALIDATED
TMEM129 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 129
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138385.2-1807s1c1
Sequence:CCGGGCCTTACTTCTCTGGAGCATACTCGAGTATGCTCCAGAGAAGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138385.2-2161s1c1
Sequence:CCGGGTTGAGGACCAAAGTGCCATACTCGAGTATGGCACTTTGGTCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138385.2-843s1c1
Sequence:CCGGGCATCCTGATCTACTACTGGTCTCGAGACCAGTAGTAGATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138385.3-723s21c1
Sequence:CCGGTCGGCTACTATGTGGGCATGTCTCGAGACATGCCCACATAGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-1528s21c1
Sequence:CCGGCTGGCAAAGGGCTCTACTTAACTCGAGTTAAGTAGAGCCCTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-1025s21c1
Sequence:CCGGACGTGGGTGATGAAGGTAACCCTCGAGGGTTACCTTCATCACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-942s21c1
Sequence:CCGGTTGCCTCCTCTGTCAACACTGCTCGAGCAGTGTTGACAGAGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-837s21c1
Sequence:CCGGTCGCCTGCATCCTGATCTACTCTCGAGAGTAGATCAGGATGCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138385
VALIDATED
TMEM129 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 129
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138385.2-1807s1c1
Sequence:CCGGGCCTTACTTCTCTGGAGCATACTCGAGTATGCTCCAGAGAAGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138385.2-2161s1c1
Sequence:CCGGGTTGAGGACCAAAGTGCCATACTCGAGTATGGCACTTTGGTCCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138385.2-843s1c1
Sequence:CCGGGCATCCTGATCTACTACTGGTCTCGAGACCAGTAGTAGATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138385.3-723s21c1
Sequence:CCGGTCGGCTACTATGTGGGCATGTCTCGAGACATGCCCACATAGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-1528s21c1
Sequence:CCGGCTGGCAAAGGGCTCTACTTAACTCGAGTTAAGTAGAGCCCTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-1025s21c1
Sequence:CCGGACGTGGGTGATGAAGGTAACCCTCGAGGGTTACCTTCATCACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-942s21c1
Sequence:CCGGTTGCCTCCTCTGTCAACACTGCTCGAGCAGTGTTGACAGAGGAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138385.3-837s21c1
Sequence:CCGGTCGCCTGCATCCTGATCTACTCTCGAGAGTAGATCAGGATGCAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026698
VALIDATED
TMEM129 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 129
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-597s21c1
Sequence:CCGGGATCTCTCGCCAGACTCAAACCTCGAGGTTTGAGTCTGGCGAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-1587s21c1
Sequence:CCGGTTCCTCACGAGGGTTGCATATCTCGAGATATGCAACCCTCGTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-1159s21c1
Sequence:CCGGTGACAAGAGGTTCTAGTTAAACTCGAGTTTAACTAGAACCTCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-451s21c1
Sequence:CCGGTCCGACGGATTGACAAGTTTGCTCGAGCAAACTTGTCAATCCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026698.2-1087s21c1
Sequence:CCGGTACGCTGAGCATCACAGTATGCTCGAGCATACTGTGATGCTCAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-501s21c1
Sequence:CCGGGTGACAGACACATGGGTAATGCTCGAGCATTACCCATGTGTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026698.2-695s21c1
Sequence:CCGGATCAGAATATGGCGAACTATGCTCGAGCATAGTTCGCCATATTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026698
VALIDATED
TMEM129 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 129
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-597s21c1
Sequence:CCGGGATCTCTCGCCAGACTCAAACCTCGAGGTTTGAGTCTGGCGAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-1587s21c1
Sequence:CCGGTTCCTCACGAGGGTTGCATATCTCGAGATATGCAACCCTCGTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-1159s21c1
Sequence:CCGGTGACAAGAGGTTCTAGTTAAACTCGAGTTTAACTAGAACCTCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-451s21c1
Sequence:CCGGTCCGACGGATTGACAAGTTTGCTCGAGCAAACTTGTCAATCCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026698.2-1087s21c1
Sequence:CCGGTACGCTGAGCATCACAGTATGCTCGAGCATACTGTGATGCTCAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-501s21c1
Sequence:CCGGGTGACAGACACATGGGTAATGCTCGAGCATTACCCATGTGTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026698.2-695s21c1
Sequence:CCGGATCAGAATATGGCGAACTATGCTCGAGCATAGTTCGCCATATTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026698
VALIDATED
TMEM129 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 129
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-597s21c1
Sequence:CCGGGATCTCTCGCCAGACTCAAACCTCGAGGTTTGAGTCTGGCGAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-1587s21c1
Sequence:CCGGTTCCTCACGAGGGTTGCATATCTCGAGATATGCAACCCTCGTGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-1159s21c1
Sequence:CCGGTGACAAGAGGTTCTAGTTAAACTCGAGTTTAACTAGAACCTCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-451s21c1
Sequence:CCGGTCCGACGGATTGACAAGTTTGCTCGAGCAAACTTGTCAATCCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026698.2-1087s21c1
Sequence:CCGGTACGCTGAGCATCACAGTATGCTCGAGCATACTGTGATGCTCAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026698.2-501s21c1
Sequence:CCGGGTGACAGACACATGGGTAATGCTCGAGCATTACCCATGTGTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026698.2-695s21c1
Sequence:CCGGATCAGAATATGGCGAACTATGCTCGAGCATAGTTCGCCATATTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks