EMAIL THIS PAGE TO A FRIEND

TMEM130

transmembrane protein 130

UniProtKB ID: Q8N3G9, A4D266, B7Z364, Q8IY46, Q8N0W9, Q8N3R2
Gene ID:
Mouse(243339) transmembrane protein 130
Rat(304280) transmembrane protein 130
cow(504372) transmembrane protein 130
sheep(101103866) transmembrane protein 130
naked mole-rat(101721071) transmembrane protein 130
Domestic Rabbit(100353820) transmembrane protein 130
domestic guinea pig(100724101) transmembrane protein 130
Zebrafish(567635) transmembrane protein 130
domestic cat(101094972) transmembrane protein 130
dog(608852) transmembrane protein 130
chicken(416439) transmembrane protein 130
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152913 Rosetta Predictions human pricing
XM_001071422 Rosetta Predictions rat pricing
XM_221896 Rosetta Predictions rat pricing
NM_177735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115016 predicted 844
2 SASI_Hs01_00115018 predicted 719
3 SASI_Hs01_00115019 predicted 1201
4 SASI_Hs01_00115020 predicted 1343
5 SASI_Hs02_00366887 predicted 613
6 SASI_Hs01_00115021 predicted 1536
7 SASI_Hs01_00115022 predicted 604
8 SASI_Hs01_00115024 predicted 1313
9 SASI_Hs01_00115025 predicted 902
10 SASI_Hs02_00366888 predicted 1198
11 SASI_Hs01_00115017 predicted 912
12 SASI_Hs01_00115023 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335100 predicted 856
2 SASI_Rn02_00335101 predicted 678
3 SASI_Rn02_00335102 predicted 199
4 SASI_Rn02_00335103 predicted 340
5 SASI_Rn02_00335104 predicted 722
6 SASI_Rn02_00335105 predicted 512
7 SASI_Rn02_00335106 predicted 585
8 SASI_Rn02_00335107 predicted 797
9 SASI_Rn02_00335108 predicted 310
10 SASI_Rn02_00335109 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380408 predicted 205
2 SASI_Rn02_00380409 predicted 514
3 SASI_Rn02_00380410 predicted 1205
4 SASI_Rn02_00380411 predicted 802
5 SASI_Rn02_00380412 predicted 1059
6 SASI_Rn02_00380413 predicted 761
7 SASI_Rn02_00380414 predicted 833
8 SASI_Rn02_00380415 predicted 1268
9 SASI_Rn02_00380416 predicted 751
10 SASI_Rn02_00380417 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179115 predicted 694
2 SASI_Mm01_00179116 predicted 600
3 SASI_Mm01_00179117 predicted 440
4 SASI_Mm01_00179118 predicted 277
5 SASI_Mm01_00179119 predicted 807
6 SASI_Mm01_00179120 predicted 984
7 SASI_Mm01_00179121 predicted 649
8 SASI_Mm01_00179122 predicted 338
9 SASI_Mm01_00179123 predicted 502
10 SASI_Mm01_00179124 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152913
TMEM130 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 130
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152913.2-1877s21c1
Sequence:CCGGGAGCTAGAAAGAAGGTCATAACTCGAGTTATGACCTTCTTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152913.2-1262s21c1
Sequence:CCGGTGTACATGACCCTGCGGAATGCTCGAGCATTCCGCAGGGTCATGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152913.2-644s21c1
Sequence:CCGGTCACTAAGACCGTCCTGAAAGCTCGAGCTTTCAGGACGGTCTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152913.1-2200s1c1
Sequence:CCGGGCAGGACTAATACTGAGTGATCTCGAGATCACTCAGTATTAGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-244s1c1
Sequence:CCGGGCCTGTATGAACTCAATCTCACTCGAGTGAGATTGAGTTCATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-1186s1c1
Sequence:CCGGCTTTCCCATGTGCTACACTTACTCGAGTAAGTGTAGCACATGGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-1358s1c1
Sequence:CCGGCCTGGAAATTGTTCGTGAGAACTCGAGTTCTCACGAACAATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-733s1c1
Sequence:CCGGCCGTGGTCTATTATAACTATTCTCGAGAATAGTTATAATAGACCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152913
TMEM130 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 130
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152913.2-1877s21c1
Sequence:CCGGGAGCTAGAAAGAAGGTCATAACTCGAGTTATGACCTTCTTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152913.2-1262s21c1
Sequence:CCGGTGTACATGACCCTGCGGAATGCTCGAGCATTCCGCAGGGTCATGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152913.2-644s21c1
Sequence:CCGGTCACTAAGACCGTCCTGAAAGCTCGAGCTTTCAGGACGGTCTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152913.1-2200s1c1
Sequence:CCGGGCAGGACTAATACTGAGTGATCTCGAGATCACTCAGTATTAGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-244s1c1
Sequence:CCGGGCCTGTATGAACTCAATCTCACTCGAGTGAGATTGAGTTCATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-1186s1c1
Sequence:CCGGCTTTCCCATGTGCTACACTTACTCGAGTAAGTGTAGCACATGGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-1358s1c1
Sequence:CCGGCCTGGAAATTGTTCGTGAGAACTCGAGTTCTCACGAACAATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-733s1c1
Sequence:CCGGCCGTGGTCTATTATAACTATTCTCGAGAATAGTTATAATAGACCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152913
TMEM130 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 130
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152913.2-1877s21c1
Sequence:CCGGGAGCTAGAAAGAAGGTCATAACTCGAGTTATGACCTTCTTTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152913.2-1262s21c1
Sequence:CCGGTGTACATGACCCTGCGGAATGCTCGAGCATTCCGCAGGGTCATGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152913.2-644s21c1
Sequence:CCGGTCACTAAGACCGTCCTGAAAGCTCGAGCTTTCAGGACGGTCTTAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005356    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152913.1-2200s1c1
Sequence:CCGGGCAGGACTAATACTGAGTGATCTCGAGATCACTCAGTATTAGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-244s1c1
Sequence:CCGGGCCTGTATGAACTCAATCTCACTCGAGTGAGATTGAGTTCATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-1186s1c1
Sequence:CCGGCTTTCCCATGTGCTACACTTACTCGAGTAAGTGTAGCACATGGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-1358s1c1
Sequence:CCGGCCTGGAAATTGTTCGTGAGAACTCGAGTTCTCACGAACAATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152913.1-733s1c1
Sequence:CCGGCCGTGGTCTATTATAACTATTCTCGAGAATAGTTATAATAGACCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177735
TMEM130 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 130
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177735.4-286s1c1
Sequence:CCGGCAAGAATGAGAAGAATCTAACCTCGAGGTTAGATTCTTCTCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177735.3-2021s1c1
Sequence:CCGGCCTTGAAATCTGTAAGCTCAACTCGAGTTGAGCTTACAGATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-499s1c1
Sequence:CCGGGAGAAGTCTTAGACTGTCCTTCTCGAGAAGGACAGTCTAAGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-1048s1c1
Sequence:CCGGCCAGCCATTTGTCTTTGCTTTCTCGAGAAAGCAAAGACAAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177735.3-2654s1c1
Sequence:CCGGGCTGAAATAGTATTGTCTCTTCTCGAGAAGAGACAATACTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-589s1c1
Sequence:CCGGGACCTTGTTGATAACTGACAACTCGAGTTGTCAGTTATCAACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177735
TMEM130 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 130
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177735.4-286s1c1
Sequence:CCGGCAAGAATGAGAAGAATCTAACCTCGAGGTTAGATTCTTCTCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177735.3-2021s1c1
Sequence:CCGGCCTTGAAATCTGTAAGCTCAACTCGAGTTGAGCTTACAGATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-499s1c1
Sequence:CCGGGAGAAGTCTTAGACTGTCCTTCTCGAGAAGGACAGTCTAAGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-1048s1c1
Sequence:CCGGCCAGCCATTTGTCTTTGCTTTCTCGAGAAAGCAAAGACAAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177735.3-2654s1c1
Sequence:CCGGGCTGAAATAGTATTGTCTCTTCTCGAGAAGAGACAATACTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-589s1c1
Sequence:CCGGGACCTTGTTGATAACTGACAACTCGAGTTGTCAGTTATCAACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177735
TMEM130 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 130
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177735.4-286s1c1
Sequence:CCGGCAAGAATGAGAAGAATCTAACCTCGAGGTTAGATTCTTCTCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201153    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177735.3-2021s1c1
Sequence:CCGGCCTTGAAATCTGTAAGCTCAACTCGAGTTGAGCTTACAGATTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-499s1c1
Sequence:CCGGGAGAAGTCTTAGACTGTCCTTCTCGAGAAGGACAGTCTAAGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-1048s1c1
Sequence:CCGGCCAGCCATTTGTCTTTGCTTTCTCGAGAAAGCAAAGACAAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177735.3-2654s1c1
Sequence:CCGGGCTGAAATAGTATTGTCTCTTCTCGAGAAGAGACAATACTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177735.3-589s1c1
Sequence:CCGGGACCTTGTTGATAACTGACAACTCGAGTTGTCAGTTATCAACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks