EMAIL THIS PAGE TO A FRIEND

TMEM131

transmembrane protein 131

Synonyms: CC28 PRO1048 RW1 YR-23
UniProtKB ID: Q92545
Gene ID:
Mouse(56030) transmembrane protein 131
Rat(316335) transmembrane protein 131
Zebrafish(557719) transmembrane protein 131
Horse(100061749) transmembrane protein 131
chicken(418689) transmembrane protein 131
dog(474566) transmembrane protein 131
domestic cat(101090254) transmembrane protein 131
domestic guinea pig(100732672) transmembrane protein 131
Domestic Rabbit(100341506) transmembrane protein 131
naked mole-rat(101717509) transmembrane protein 131
cow(540861) transmembrane protein 131
sheep(101112388) transmembrane protein 131
159 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015348 Rosetta Predictions human pricing
XM_371542 Rosetta Predictions human pricing
XM_933735 Rosetta Predictions human pricing
XM_933739 Rosetta Predictions human pricing
XM_933743 Rosetta Predictions human pricing
XM_933745 Rosetta Predictions human pricing
XM_001056771 Rosetta Predictions rat pricing
XM_237056 Rosetta Predictions rat pricing
NM_018872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347654 predicted 1174
2 SASI_Hs02_00347655 predicted 2359
3 SASI_Hs02_00347656 predicted 638
4 SASI_Hs02_00347657 predicted 1704
5 SASI_Hs02_00347658 predicted 2795
6 SASI_Hs02_00347659 predicted 1582
7 SASI_Hs02_00347660 predicted 5384
8 SASI_Hs02_00347661 predicted 1195
9 SASI_Hs02_00347662 predicted 2877
10 SASI_Hs02_00347663 predicted 3667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279864 predicted 3605
2 SASI_Hs01_00279865 predicted 2361
3 SASI_Hs01_00279866 predicted 644
4 SASI_Hs01_00279867 predicted 1792
5 SASI_Hs01_00279868 predicted 1712
6 SASI_Hs01_00279869 predicted 2807
7 SASI_Hs01_00279870 predicted 1598
8 SASI_Hs01_00279871 predicted 1060
9 SASI_Hs01_00279872 predicted 1550
10 SASI_Hs01_00279873 predicted 2879
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265628 predicted 6621
2 SASI_Hs01_00265629 predicted 6723
3 SASI_Hs01_00265630 predicted 6232
4 SASI_Hs01_00265631 predicted 6898
5 SASI_Hs01_00265632 predicted 6204
6 SASI_Hs01_00265633 predicted 6961
7 SASI_Hs01_00265634 predicted 6278
8 SASI_Hs01_00265635 predicted 6958
9 SASI_Hs01_00265636 predicted 6318
10 SASI_Hs01_00265637 predicted 6873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298343 predicted 794
2 SASI_Hs01_00298344 predicted 904
3 SASI_Hs01_00298345 predicted 286
4 SASI_Hs01_00298346 predicted 1075
5 SASI_Hs01_00298347 predicted 270
6 SASI_Hs01_00298348 predicted 1141
7 SASI_Hs01_00298349 predicted 260
8 SASI_Hs01_00298350 predicted 457
9 SASI_Hs01_00298351 predicted 397
10 SASI_Hs01_00298352 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282896 predicted 953
2 SASI_Hs01_00282897 predicted 1066
3 SASI_Hs01_00282898 predicted 1227
4 SASI_Hs01_00282899 predicted 1300
5 SASI_Hs01_00282900 predicted 611
6 SASI_Hs01_00282901 predicted 409
7 SASI_Hs01_00282902 predicted 547
8 SASI_Hs01_00282903 predicted 1293
9 SASI_Hs01_00282904 predicted 664
10 SASI_Hs01_00282905 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290907 predicted 1604
2 SASI_Hs01_00290908 predicted 1720
3 SASI_Hs01_00290909 predicted 775
4 SASI_Hs01_00290910 predicted 613
5 SASI_Hs01_00290911 predicted 761
6 SASI_Hs01_00290912 predicted 616
7 SASI_Hs01_00290913 predicted 1264
8 SASI_Hs01_00290914 predicted 1065
9 SASI_Hs01_00290915 predicted 1210
10 SASI_Hs01_00290916 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284376 predicted 563
2 SASI_Rn02_00284377 predicted 1810
3 SASI_Rn02_00284378 predicted 1596
4 SASI_Rn02_00284379 predicted 886
5 SASI_Rn02_00284380 predicted 3310
6 SASI_Rn02_00284381 predicted 5743
7 SASI_Rn02_00284382 predicted 2316
8 SASI_Rn02_00284383 predicted 1263
9 SASI_Rn02_00284384 predicted 3284
10 SASI_Rn02_00284385 predicted 2827
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390620 predicted 556
2 SASI_Rn02_00390621 predicted 1808
3 SASI_Rn02_00390622 predicted 1598
4 SASI_Rn02_00390623 predicted 882
5 SASI_Rn02_00390624 predicted 3307
6 SASI_Rn02_00390625 predicted 5745
7 SASI_Rn02_00390626 predicted 2314
8 SASI_Rn02_00390627 predicted 1265
9 SASI_Rn02_00390628 predicted 3277
10 SASI_Rn02_00390629 predicted 2835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104861 predicted 590
2 SASI_Mm01_00104863 predicted 2697
3 SASI_Mm01_00104864 predicted 1809
4 SASI_Mm01_00104865 predicted 4793
5 SASI_Mm01_00104866 predicted 1655
6 SASI_Mm02_00324255 predicted 986
7 SASI_Mm02_00324256 predicted 1604
8 SASI_Mm02_00324257 predicted 3281
9 SASI_Mm01_00104869 predicted 2515
10 SASI_Mm02_00324258 predicted 3318
11 SASI_Mm01_00104862 predicted 685
12 SASI_Mm01_00104867 predicted 1823
13 SASI_Mm01_00104868 predicted 3397
14 SASI_Mm01_00104870 predicted 1950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018872
VALIDATED
TMEM131 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 131
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018872.1-6016s1c1
Sequence:CCGGCAGAAATGTAAGCCAGCGTAACTCGAGTTACGCTGGCTTACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.1-849s1c2
Sequence:CCGGCCTCAACTGAAATGTTAGATTCTCGAGAATCTAACATTTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5689s1c1
Sequence:CCGGGCTGTTGTGCTTAAAGACAAACTCGAGTTTGTCTTTAAGCACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5819s1c1
Sequence:CCGGCATTACAGTTAAGGGAGTGATCTCGAGATCACTCCCTTAACTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018872.1-145s1c1
Sequence:CCGGCCTCGGTTCATATCAACAGAACTCGAGTTCTGTTGATATGAACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5119s1c1
Sequence:CCGGCCAGAGAAGTTGGAATGAGTTCTCGAGAACTCATTCCAACTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-1049s21c1
Sequence:CCCGCACAGCCTTCATCCGGATAAACTCGAGTTTATCCGGATGAAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-4711s21c1
Sequence:CCGGGTGGATCCAAATCACGAAATCCTCGAGGATTTCGTGATTTGGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-2322s1c1
Sequence:CCGGCGATTCTACTACAAACGATTACTCGAGTAATCGTTTGTAGTAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-3689s1c1
Sequence:CCGGCAGGAGAATCGTTGGTATTTCCTCGAGGAAATACCAACGATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-4802s1c1
Sequence:CCGGCAGTCAAGAACTAGGTAATACCTCGAGGTATTACCTAGTTCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-2800s21c1
Sequence:CCGGCCGTCTTTGCAGATAAGTTAGCTCGAGCTAACTTATCTGCAAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-1454s21c1
Sequence:CCGGAGAAGTTCTAGATGGTTATTTCTCGAGAAATAACCATCTAGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-4801s21c1
Sequence:CCGGGCAGTCAAGAACTAGGTAATACTCGAGTATTACCTAGTTCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-369s21c1
Sequence:CCGCATTCAGTCGGAGAGCATAATACTCGAGTATTATGCTCTCCGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018872
VALIDATED
TMEM131 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 131
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018872.1-6016s1c1
Sequence:CCGGCAGAAATGTAAGCCAGCGTAACTCGAGTTACGCTGGCTTACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.1-849s1c2
Sequence:CCGGCCTCAACTGAAATGTTAGATTCTCGAGAATCTAACATTTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5689s1c1
Sequence:CCGGGCTGTTGTGCTTAAAGACAAACTCGAGTTTGTCTTTAAGCACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5819s1c1
Sequence:CCGGCATTACAGTTAAGGGAGTGATCTCGAGATCACTCCCTTAACTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018872.1-145s1c1
Sequence:CCGGCCTCGGTTCATATCAACAGAACTCGAGTTCTGTTGATATGAACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5119s1c1
Sequence:CCGGCCAGAGAAGTTGGAATGAGTTCTCGAGAACTCATTCCAACTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-1049s21c1
Sequence:CCCGCACAGCCTTCATCCGGATAAACTCGAGTTTATCCGGATGAAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-4711s21c1
Sequence:CCGGGTGGATCCAAATCACGAAATCCTCGAGGATTTCGTGATTTGGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-2322s1c1
Sequence:CCGGCGATTCTACTACAAACGATTACTCGAGTAATCGTTTGTAGTAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-3689s1c1
Sequence:CCGGCAGGAGAATCGTTGGTATTTCCTCGAGGAAATACCAACGATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-4802s1c1
Sequence:CCGGCAGTCAAGAACTAGGTAATACCTCGAGGTATTACCTAGTTCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-2800s21c1
Sequence:CCGGCCGTCTTTGCAGATAAGTTAGCTCGAGCTAACTTATCTGCAAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-1454s21c1
Sequence:CCGGAGAAGTTCTAGATGGTTATTTCTCGAGAAATAACCATCTAGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-4801s21c1
Sequence:CCGGGCAGTCAAGAACTAGGTAATACTCGAGTATTACCTAGTTCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-369s21c1
Sequence:CCGCATTCAGTCGGAGAGCATAATACTCGAGTATTATGCTCTCCGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018872
VALIDATED
TMEM131 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 131
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018872.1-6016s1c1
Sequence:CCGGCAGAAATGTAAGCCAGCGTAACTCGAGTTACGCTGGCTTACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.1-849s1c2
Sequence:CCGGCCTCAACTGAAATGTTAGATTCTCGAGAATCTAACATTTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5689s1c1
Sequence:CCGGGCTGTTGTGCTTAAAGACAAACTCGAGTTTGTCTTTAAGCACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5819s1c1
Sequence:CCGGCATTACAGTTAAGGGAGTGATCTCGAGATCACTCCCTTAACTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018872.1-145s1c1
Sequence:CCGGCCTCGGTTCATATCAACAGAACTCGAGTTCTGTTGATATGAACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018872.1-5119s1c1
Sequence:CCGGCCAGAGAAGTTGGAATGAGTTCTCGAGAACTCATTCCAACTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-1049s21c1
Sequence:CCCGCACAGCCTTCATCCGGATAAACTCGAGTTTATCCGGATGAAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-4711s21c1
Sequence:CCGGGTGGATCCAAATCACGAAATCCTCGAGGATTTCGTGATTTGGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-2322s1c1
Sequence:CCGGCGATTCTACTACAAACGATTACTCGAGTAATCGTTTGTAGTAGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-3689s1c1
Sequence:CCGGCAGGAGAATCGTTGGTATTTCCTCGAGGAAATACCAACGATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018872.2-4802s1c1
Sequence:CCGGCAGTCAAGAACTAGGTAATACCTCGAGGTATTACCTAGTTCTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-2800s21c1
Sequence:CCGGCCGTCTTTGCAGATAAGTTAGCTCGAGCTAACTTATCTGCAAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-1454s21c1
Sequence:CCGGAGAAGTTCTAGATGGTTATTTCTCGAGAAATAACCATCTAGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-4801s21c1
Sequence:CCGGGCAGTCAAGAACTAGGTAATACTCGAGTATTACCTAGTTCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018872.2-369s21c1
Sequence:CCGCATTCAGTCGGAGAGCATAATACTCGAGTATTATGCTCTCCGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015348
VALIDATED
TMEM131 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 131
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-2627s21c1
Sequence:CCGGCATAGATTGAGTGCTATATTTCTCGAGAAATATAGCACTCAATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-5839s21c1
Sequence:CCGGCTCGGACCCTTGGTCTAATTCCTCGAGGAATTAGACCAAGGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-1948s21c1
Sequence:CCGGTCCAATTGAGTTGGCTATAAACTCGAGTTTATAGCCAACTCAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-6313s21c1
Sequence:CCGGATTATGCGCCAAGATCTAATTCTCGAGAATTAGATCTTGGCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015348.1-898s21c1
Sequence:CCGGTAGCAGTTTCTCACCTATAATCTCGAGATTATAGGTGAGAAACTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015348
VALIDATED
TMEM131 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 131
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-2627s21c1
Sequence:CCGGCATAGATTGAGTGCTATATTTCTCGAGAAATATAGCACTCAATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-5839s21c1
Sequence:CCGGCTCGGACCCTTGGTCTAATTCCTCGAGGAATTAGACCAAGGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-1948s21c1
Sequence:CCGGTCCAATTGAGTTGGCTATAAACTCGAGTTTATAGCCAACTCAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-6313s21c1
Sequence:CCGGATTATGCGCCAAGATCTAATTCTCGAGAATTAGATCTTGGCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015348.1-898s21c1
Sequence:CCGGTAGCAGTTTCTCACCTATAATCTCGAGATTATAGGTGAGAAACTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015348
VALIDATED
TMEM131 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 131
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-2627s21c1
Sequence:CCGGCATAGATTGAGTGCTATATTTCTCGAGAAATATAGCACTCAATCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-5839s21c1
Sequence:CCGGCTCGGACCCTTGGTCTAATTCCTCGAGGAATTAGACCAAGGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-1948s21c1
Sequence:CCGGTCCAATTGAGTTGGCTATAAACTCGAGTTTATAGCCAACTCAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015348.1-6313s21c1
Sequence:CCGGATTATGCGCCAAGATCTAATTCTCGAGAATTAGATCTTGGCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015348.1-898s21c1
Sequence:CCGGTAGCAGTTTCTCACCTATAATCTCGAGATTATAGGTGAGAAACTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks