EMAIL THIS PAGE TO A FRIEND

TMEM132A

transmembrane protein 132A

Synonyms: GBP HSPA5BP1
Gene ID:
Human(54972) Summary: This gene encodes a protein that is highly similar to the rat Grp78-binding protein (GBP). Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(98170) transmembrane protein 132A
Rat(338474) transmembrane protein 132A
cow(540137) transmembrane protein 132A
sheep(101121638) transmembrane protein 132A
naked mole-rat(101720815) transmembrane protein 132A
Domestic Rabbit(100358761) transmembrane protein 132A
domestic guinea pig(100722241) transmembrane protein 132A
Horse(100062008) transmembrane protein 132A
domestic cat(101082517) transmembrane protein 132A
dog(612353) transmembrane protein 132A
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017870 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017870 Rosetta Predictions human pricing
NM_178031 Rosetta Predictions human pricing
NM_178021 Rosetta Predictions rat pricing
NM_133804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107723 predicted 3079
2 SASI_Hs01_00107724 predicted 1506
3 SASI_Hs01_00107725 predicted 3078
4 SASI_Hs01_00107726 predicted 1420
5 SASI_Hs02_00350803 predicted 403
6 SASI_Hs01_00107727 predicted 1570
7 SASI_Hs01_00107729 predicted 2299
8 SASI_Hs01_00107730 predicted 2118
9 SASI_Hs01_00107731 predicted 2176
10 SASI_Hs01_00107732 predicted 2330
11 SASI_Hs01_00107728 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158983 predicted 3075
2 SASI_Hs01_00158984 predicted 1504
3 SASI_Hs01_00158985 predicted 3075
4 SASI_Hs01_00158986 predicted 1417
5 SASI_Hs02_00369513 predicted 410
6 SASI_Hs01_00158987 predicted 1562
7 SASI_Hs01_00158989 predicted 2298
8 SASI_Hs01_00158990 predicted 2112
9 SASI_Hs01_00158991 predicted 2171
10 SASI_Hs01_00158992 predicted 2325
11 SASI_Hs01_00158988 predicted 1504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104602 predicted 1462
2 SASI_Rn01_00104603 predicted 907
3 SASI_Rn01_00104604 predicted 1695
4 SASI_Rn01_00104605 predicted 746
5 SASI_Rn01_00104606 predicted 897
6 SASI_Rn01_00104607 predicted 693
7 SASI_Rn01_00104608 predicted 922
8 SASI_Rn01_00104609 predicted 1245
9 SASI_Rn01_00104610 predicted 1773
10 SASI_Rn02_00269607 predicted 1203
11 SASI_Rn01_00104611 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137164 predicted 2727
2 SASI_Mm02_00338831 predicted 900
3 SASI_Mm01_00137165 predicted 230
4 SASI_Mm01_00137166 predicted 1356
5 SASI_Mm01_00137167 predicted 976
6 SASI_Mm01_00137168 predicted 1083
7 SASI_Mm01_00137169 predicted 1591
8 SASI_Mm01_00137171 predicted 231
9 SASI_Mm01_00137172 predicted 985
10 SASI_Mm01_00137173 predicted 1069
11 SASI_Mm01_00137170 predicted 3171
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017870
TMEM132A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017870.3-621s21c1
Sequence:CCGGTCCACCTCAAAGGGCAGGATTCTCGAGAATCCTGCCCTTTGAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017870.3-3348s21c1
Sequence:CCGGACTCGTCTGGTGCTTGTTGATCTCGAGATCAACAAGCACCAGACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017870.3-3223s21c1
Sequence:CCGGTGAGGAGCTTCGCAACTACATCTCGAGATGTAGTTGCGAAGCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-2737s1c1
Sequence:CCGGCGTGGCCATCTTCATCTTCTTCTCGAGAAGAAGATGAAGATGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3053s1c1
Sequence:CCGGGAGTTTGTGACATTTGCGCCACTCGAGTGGCGCAAATGTCACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-2743s1c1
Sequence:CCGGCATCTTCATCTTCTTGGTCAACTCGAGTTGACCAAGAAGATGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3047s1c1
Sequence:CCGGCGAGTAGAGTTTGTGACATTTCTCGAGAAATGTCACAAACTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-1196s1c1
Sequence:CCGGGAGTTCCTATGGGTGGACTTTCTCGAGAAAGTCCACCCATAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3046s1c1
Sequence:CCGGGCGAGTAGAGTTTGTGACATTCTCGAGAATGTCACAAACTCTACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017870
TMEM132A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017870.3-621s21c1
Sequence:CCGGTCCACCTCAAAGGGCAGGATTCTCGAGAATCCTGCCCTTTGAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017870.3-3348s21c1
Sequence:CCGGACTCGTCTGGTGCTTGTTGATCTCGAGATCAACAAGCACCAGACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017870.3-3223s21c1
Sequence:CCGGTGAGGAGCTTCGCAACTACATCTCGAGATGTAGTTGCGAAGCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-2737s1c1
Sequence:CCGGCGTGGCCATCTTCATCTTCTTCTCGAGAAGAAGATGAAGATGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3053s1c1
Sequence:CCGGGAGTTTGTGACATTTGCGCCACTCGAGTGGCGCAAATGTCACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-2743s1c1
Sequence:CCGGCATCTTCATCTTCTTGGTCAACTCGAGTTGACCAAGAAGATGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3047s1c1
Sequence:CCGGCGAGTAGAGTTTGTGACATTTCTCGAGAAATGTCACAAACTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-1196s1c1
Sequence:CCGGGAGTTCCTATGGGTGGACTTTCTCGAGAAAGTCCACCCATAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3046s1c1
Sequence:CCGGGCGAGTAGAGTTTGTGACATTCTCGAGAATGTCACAAACTCTACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017870
TMEM132A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017870.3-621s21c1
Sequence:CCGGTCCACCTCAAAGGGCAGGATTCTCGAGAATCCTGCCCTTTGAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017870.3-3348s21c1
Sequence:CCGGACTCGTCTGGTGCTTGTTGATCTCGAGATCAACAAGCACCAGACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017870.3-3223s21c1
Sequence:CCGGTGAGGAGCTTCGCAACTACATCTCGAGATGTAGTTGCGAAGCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-2737s1c1
Sequence:CCGGCGTGGCCATCTTCATCTTCTTCTCGAGAAGAAGATGAAGATGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3053s1c1
Sequence:CCGGGAGTTTGTGACATTTGCGCCACTCGAGTGGCGCAAATGTCACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-2743s1c1
Sequence:CCGGCATCTTCATCTTCTTGGTCAACTCGAGTTGACCAAGAAGATGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3047s1c1
Sequence:CCGGCGAGTAGAGTTTGTGACATTTCTCGAGAAATGTCACAAACTCTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-1196s1c1
Sequence:CCGGGAGTTCCTATGGGTGGACTTTCTCGAGAAAGTCCACCCATAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017870.2-3046s1c1
Sequence:CCGGGCGAGTAGAGTTTGTGACATTCTCGAGAATGTCACAAACTCTACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133804
VALIDATED
TMEM132A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-993s21c1
Sequence:CCGGCCTTCTTACTCTGCGGATTAACTCGAGTTAATCCGCAGAGTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-232s21c1
Sequence:CCGGGTCGTGAGAGTTAGCAGTAACCTCGAGGTTACTGCTAACTCTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-1647s21c1
Sequence:CCGGTGACACCACTCTGGAACAAATCTCGAGATTTGTTCCAGAGTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-1061s21c1
Sequence:CCGGCCCTCTGGACTGCTAAGTTAGCTCGAGCTAACTTAGCAGTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133804.2-3263s21c1
Sequence:CCGGCCAATGGGATCGCTGGCTAATCTCGAGATTAGCCAGCGATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-981s21c1
Sequence:CCGGCTTCACTGCGAGCCTTCTTACCTCGAGGTAAGAAGGCTCGCAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-3258s1c1
Sequence:CCGGCATCCTCTGGTGCTTGTTGATCTCGAGATCAACAAGCACCAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133804.1-1544s1c1
Sequence:CCGGCCTCACTAAAGCTGACTGTATCTCGAGATACAGTCAGCTTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-2974s1c1
Sequence:CCGGCGAGTCGAGTTTGTGACATTTCTCGAGAAATGTCACAAACTCGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-2680s1c1
Sequence:CCGGCTGGTCAATGGTGTGGTCTTTCTCGAGAAAGACCACACCATTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133804.1-1314s1c1
Sequence:CCGGGCTGGTGAACACGGCTCCATTCTCGAGAATGGAGCCGTGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133804
VALIDATED
TMEM132A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-993s21c1
Sequence:CCGGCCTTCTTACTCTGCGGATTAACTCGAGTTAATCCGCAGAGTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-232s21c1
Sequence:CCGGGTCGTGAGAGTTAGCAGTAACCTCGAGGTTACTGCTAACTCTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-1647s21c1
Sequence:CCGGTGACACCACTCTGGAACAAATCTCGAGATTTGTTCCAGAGTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-1061s21c1
Sequence:CCGGCCCTCTGGACTGCTAAGTTAGCTCGAGCTAACTTAGCAGTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133804.2-3263s21c1
Sequence:CCGGCCAATGGGATCGCTGGCTAATCTCGAGATTAGCCAGCGATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-981s21c1
Sequence:CCGGCTTCACTGCGAGCCTTCTTACCTCGAGGTAAGAAGGCTCGCAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-3258s1c1
Sequence:CCGGCATCCTCTGGTGCTTGTTGATCTCGAGATCAACAAGCACCAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133804.1-1544s1c1
Sequence:CCGGCCTCACTAAAGCTGACTGTATCTCGAGATACAGTCAGCTTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-2974s1c1
Sequence:CCGGCGAGTCGAGTTTGTGACATTTCTCGAGAAATGTCACAAACTCGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-2680s1c1
Sequence:CCGGCTGGTCAATGGTGTGGTCTTTCTCGAGAAAGACCACACCATTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133804.1-1314s1c1
Sequence:CCGGGCTGGTGAACACGGCTCCATTCTCGAGAATGGAGCCGTGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133804
VALIDATED
TMEM132A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-993s21c1
Sequence:CCGGCCTTCTTACTCTGCGGATTAACTCGAGTTAATCCGCAGAGTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-232s21c1
Sequence:CCGGGTCGTGAGAGTTAGCAGTAACCTCGAGGTTACTGCTAACTCTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-1647s21c1
Sequence:CCGGTGACACCACTCTGGAACAAATCTCGAGATTTGTTCCAGAGTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-1061s21c1
Sequence:CCGGCCCTCTGGACTGCTAAGTTAGCTCGAGCTAACTTAGCAGTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133804.2-3263s21c1
Sequence:CCGGCCAATGGGATCGCTGGCTAATCTCGAGATTAGCCAGCGATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133804.2-981s21c1
Sequence:CCGGCTTCACTGCGAGCCTTCTTACCTCGAGGTAAGAAGGCTCGCAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-3258s1c1
Sequence:CCGGCATCCTCTGGTGCTTGTTGATCTCGAGATCAACAAGCACCAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133804.1-1544s1c1
Sequence:CCGGCCTCACTAAAGCTGACTGTATCTCGAGATACAGTCAGCTTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-2974s1c1
Sequence:CCGGCGAGTCGAGTTTGTGACATTTCTCGAGAAATGTCACAAACTCGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133804.1-2680s1c1
Sequence:CCGGCTGGTCAATGGTGTGGTCTTTCTCGAGAAAGACCACACCATTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133804.1-1314s1c1
Sequence:CCGGGCTGGTGAACACGGCTCCATTCTCGAGAATGGAGCCGTGTTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks