EMAIL THIS PAGE TO A FRIEND

TMEM132B

transmembrane protein 132B

UniProtKB ID: Q14DG7, A2RRG8, Q8NA73, Q96JN9, Q96PY1
Gene ID:
Mouse(208151) transmembrane protein 132B
Rat(304458) transmembrane protein 132B
chicken(416810) transmembrane protein 132B
Horse(100061795) transmembrane protein 132B
domestic cat(101082698) transmembrane protein 132B
dog(486238) transmembrane protein 132B
domestic guinea pig(100719644) transmembrane protein 132B
naked mole-rat(101705866) transmembrane protein 132B
cow(540363) transmembrane protein 132B
sheep(101120275) transmembrane protein 132B
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052907 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051281 MISSION® esiRNA esiRNA human TMEM132B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052907 Rosetta Predictions human pricing
NM_001134536 Rosetta Predictions rat pricing
XM_915709 Rosetta Predictions mouse pricing
XM_979000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048940 predicted 1101
2 SASI_Hs01_00048941 predicted 1413
3 SASI_Hs01_00048942 predicted 2151
4 SASI_Hs01_00048943 predicted 933
5 SASI_Hs01_00048944 predicted 458
6 SASI_Hs01_00048945 predicted 406
7 SASI_Hs01_00048946 predicted 3265
8 SASI_Hs01_00048947 predicted 1945
9 SASI_Hs01_00048948 predicted 2353
10 SASI_Hs02_00361664 predicted 2097
11 SASI_Hs01_00048949 predicted 3082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256849 predicted 3001
2 SASI_Rn02_00256850 predicted 2620
3 SASI_Rn02_00256851 predicted 1275
4 SASI_Rn02_00256852 predicted 284
5 SASI_Rn02_00256853 predicted 3071
6 SASI_Rn02_00256854 predicted 1382
7 SASI_Rn02_00256855 predicted 1669
8 SASI_Rn02_00256856 predicted 1969
9 SASI_Rn02_00256857 predicted 2632
10 SASI_Rn02_00256858 predicted 1912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439699 predicted 3182
2 SASI_Mm02_00439700 predicted 525
3 SASI_Mm02_00439701 predicted 466
4 SASI_Mm02_00439702 predicted 2746
5 SASI_Mm02_00439703 predicted 3248
6 SASI_Mm02_00439704 predicted 597
7 SASI_Mm02_00439705 predicted 2431
8 SASI_Mm02_00439706 predicted 1849
9 SASI_Mm02_00439707 predicted 447
10 SASI_Mm02_00439708 predicted 2430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254686 predicted 748
2 SASI_Mm01_00254687 predicted 690
3 SASI_Mm02_00446772 predicted 802
4 SASI_Mm01_00254688 predicted 2963
5 SASI_Mm01_00254690 predicted 1703
6 SASI_Mm01_00254691 predicted 814
7 SASI_Mm02_00446773 predicted 2150
8 SASI_Mm01_00254692 predicted 2074
9 SASI_Mm02_00446774 predicted 658
10 SASI_Mm02_00446775 predicted 2647
11 SASI_Mm01_00254684 predicted 3313
12 SASI_Mm01_00254685 predicted 3407
13 SASI_Mm01_00254689 predicted 3470
14 SASI_Mm01_00254693 predicted 3564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052907
TMEM132B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1099s1c1
Sequence:CCGGCCAAGGAGGCAGCAATGATATCTCGAGATATCATTGCTGCCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1583s1c1
Sequence:CCGGCCTGTTGACATTACACTCCCACTCGAGTGGGAGTGTAATGTCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1227s1c1
Sequence:CCGGGCCAAGAGGAAAGTACCAACACTCGAGTGTTGGTACTTTCCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1003s1c1
Sequence:CCGGGATAAGTGAACCTTGTCAGAACTCGAGTTCTGACAAGGTTCACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-843s1c1
Sequence:CCGGCGGTGACACCTTTAGACATTTCTCGAGAAATGTCTAAAGGTGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1843s1c1
Sequence:CCGGCCTGTTTGACAGCGATGATAACTCGAGTTATCATCGCTGTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1584s1c1
Sequence:CCGGCTGTTGACATTACACTCCCATCTCGAGATGGGAGTGTAATGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-494s1c1
Sequence:CCGGCAGTTTGACATCACTGACCTTCTCGAGAAGGTCAGTGATGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1048s1c1
Sequence:CCGGCGTGGGTAAAGGAAATGTCAACTCGAGTTGACATTTCCTTTACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1553s1c1
Sequence:CCGGCTTGGGAATGAAGTGGAACTTCTCGAGAAGTTCCACTTCATTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052907
TMEM132B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1099s1c1
Sequence:CCGGCCAAGGAGGCAGCAATGATATCTCGAGATATCATTGCTGCCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1583s1c1
Sequence:CCGGCCTGTTGACATTACACTCCCACTCGAGTGGGAGTGTAATGTCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1227s1c1
Sequence:CCGGGCCAAGAGGAAAGTACCAACACTCGAGTGTTGGTACTTTCCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1003s1c1
Sequence:CCGGGATAAGTGAACCTTGTCAGAACTCGAGTTCTGACAAGGTTCACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-843s1c1
Sequence:CCGGCGGTGACACCTTTAGACATTTCTCGAGAAATGTCTAAAGGTGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1843s1c1
Sequence:CCGGCCTGTTTGACAGCGATGATAACTCGAGTTATCATCGCTGTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1584s1c1
Sequence:CCGGCTGTTGACATTACACTCCCATCTCGAGATGGGAGTGTAATGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-494s1c1
Sequence:CCGGCAGTTTGACATCACTGACCTTCTCGAGAAGGTCAGTGATGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1048s1c1
Sequence:CCGGCGTGGGTAAAGGAAATGTCAACTCGAGTTGACATTTCCTTTACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1553s1c1
Sequence:CCGGCTTGGGAATGAAGTGGAACTTCTCGAGAAGTTCCACTTCATTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052907
TMEM132B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1099s1c1
Sequence:CCGGCCAAGGAGGCAGCAATGATATCTCGAGATATCATTGCTGCCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1583s1c1
Sequence:CCGGCCTGTTGACATTACACTCCCACTCGAGTGGGAGTGTAATGTCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1227s1c1
Sequence:CCGGGCCAAGAGGAAAGTACCAACACTCGAGTGTTGGTACTTTCCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1003s1c1
Sequence:CCGGGATAAGTGAACCTTGTCAGAACTCGAGTTCTGACAAGGTTCACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-843s1c1
Sequence:CCGGCGGTGACACCTTTAGACATTTCTCGAGAAATGTCTAAAGGTGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1843s1c1
Sequence:CCGGCCTGTTTGACAGCGATGATAACTCGAGTTATCATCGCTGTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1584s1c1
Sequence:CCGGCTGTTGACATTACACTCCCATCTCGAGATGGGAGTGTAATGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-494s1c1
Sequence:CCGGCAGTTTGACATCACTGACCTTCTCGAGAAGGTCAGTGATGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1048s1c1
Sequence:CCGGCGTGGGTAAAGGAAATGTCAACTCGAGTTGACATTTCCTTTACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052907.1-1553s1c1
Sequence:CCGGCTTGGGAATGAAGTGGAACTTCTCGAGAAGTTCCACTTCATTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks