EMAIL THIS PAGE TO A FRIEND

TMEM132C

transmembrane protein 132C

UniProtKB ID: Q8N3T6, Q69YX8
Gene ID:
Mouse(208213) transmembrane protein 132C
Rat(363915) transmembrane protein 132C
cow(512602) transmembrane protein 132C
sheep(101119508) transmembrane protein 132C
naked mole-rat(101702154) transmembrane protein 132C
domestic guinea pig(100728650) transmembrane protein 132C
Zebrafish(100332191) transmembrane protein 132C
domestic cat(101082188) transmembrane protein 132C
Horse(100062584) transmembrane protein 132C
dog(403528) transmembrane protein 132C
chicken(416809) transmembrane protein 132C
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136103 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715575 Rosetta Predictions human pricing
XM_044062 Rosetta Predictions human pricing
XM_941994 Rosetta Predictions human pricing
XM_344107 Rosetta Predictions rat pricing
XR_009243 Rosetta Predictions rat pricing
XM_915891 Rosetta Predictions mouse pricing
XM_979559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00404680 predicted 1225
2 SASI_Hs02_00404681 predicted 1189
3 SASI_Hs02_00404682 predicted 3378
4 SASI_Hs02_00404683 predicted 2856
5 SASI_Hs02_00404684 predicted 1881
6 SASI_Hs02_00404685 predicted 2172
7 SASI_Hs02_00404686 predicted 2070
8 SASI_Hs02_00404687 predicted 1335
9 SASI_Hs02_00404688 predicted 1458
10 SASI_Hs02_00404689 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_044062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478668 predicted 3326
2 SASI_Hs02_00478669 predicted 1156
3 SASI_Hs02_00478670 predicted 397
4 SASI_Hs01_00286728 predicted 3322
5 SASI_Hs02_00478671 predicted 1123
6 SASI_Hs01_00286729 predicted 3314
7 SASI_Hs01_00286730 predicted 2794
8 SASI_Hs01_00286731 predicted 1816
9 SASI_Hs01_00286732 predicted 3192
10 SASI_Hs01_00286733 predicted 2105
11 SASI_Hs01_00286734 predicted 1456
12 SASI_Hs01_00286735 predicted 934
13 SASI_Hs01_00286736 predicted 841
14 SASI_Hs01_00286737 predicted 2785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485183 predicted 1932
2 SASI_Hs02_00485184 predicted 2270
3 SASI_Hs02_00485185 predicted 1927
4 SASI_Hs02_00485186 predicted 1406
5 SASI_Hs02_00485187 predicted 434
6 SASI_Hs02_00485188 predicted 714
7 SASI_Hs02_00485189 predicted 611
8 SASI_Hs02_00485190 predicted 2142
9 SASI_Hs02_00485191 predicted 2078
10 SASI_Hs02_00485192 predicted 1937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123264 predicted 396
2 SASI_Rn01_00123265 predicted 1403
3 SASI_Rn01_00123266 predicted 1662
4 SASI_Rn01_00123267 predicted 1317
5 SASI_Rn01_00123268 predicted 1435
6 SASI_Rn01_00123269 predicted 1912
7 SASI_Rn01_00123270 predicted 912
8 SASI_Rn01_00123271 predicted 918
9 SASI_Rn01_00123272 predicted 1827
10 SASI_Rn01_00123273 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191284 predicted 1389
2 SASI_Rn01_00191285 predicted 642
3 SASI_Rn01_00191288 predicted 551
4 SASI_Rn02_00419186 predicted 1073
5 SASI_Rn01_00191292 predicted 1087
6 SASI_Rn02_00419187 predicted 1742
7 SASI_Rn02_00419188 predicted 392
8 SASI_Rn02_00419189 predicted 1405
9 SASI_Rn02_00419190 predicted 2136
10 SASI_Rn02_00419191 predicted 785
11 SASI_Rn01_00191286 predicted 1423
12 SASI_Rn01_00191287 predicted 1078
13 SASI_Rn01_00191289 predicted 388
14 SASI_Rn01_00191290 predicted 951
15 SASI_Rn01_00191291 predicted 1408
16 SASI_Rn01_00191293 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439832 predicted 1319
2 SASI_Mm02_00439833 predicted 606
3 SASI_Mm02_00439834 predicted 2595
4 SASI_Mm02_00439835 predicted 947
5 SASI_Mm02_00439836 predicted 387
6 SASI_Mm02_00439837 predicted 2849
7 SASI_Mm02_00439838 predicted 1000
8 SASI_Mm02_00439839 predicted 3036
9 SASI_Mm02_00439840 predicted 1914
10 SASI_Mm02_00439841 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250986 predicted 1318
2 SASI_Mm01_00250987 predicted 607
3 SASI_Mm01_00250988 predicted 2598
4 SASI_Mm01_00250989 predicted 947
5 SASI_Mm01_00250990 predicted 384
6 SASI_Mm01_00250991 predicted 2846
7 SASI_Mm01_00250992 predicted 1000
8 SASI_Mm01_00250993 predicted 3039
9 SASI_Mm01_00250994 predicted 1915
10 SASI_Mm01_00250995 predicted 1407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136103
TMEM132C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1017s21c1
Sequence:CCGGCAACAGGAGCAGCAGTTTATTCTCGAGAATAAACTGCTGCTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1358s21c1
Sequence:CCGGAGCGCTGTGACTACATCTTTGCTCGAGCAAAGATGTAGTCACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1504s21c1
Sequence:CCGGACGGAGCTCAGCCAGATAAAGCTCGAGCTTTATCTGGCTGAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136103.1-3955s21c1
Sequence:CCGGATCCATTGTTTAAGTAGTAACCTCGAGGTTACTACTTAAACAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1326s21c1
Sequence:CCGGGTCCACAGACGAGGACGTTATCTCGAGATAACGTCCTCGTCTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136103
TMEM132C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1017s21c1
Sequence:CCGGCAACAGGAGCAGCAGTTTATTCTCGAGAATAAACTGCTGCTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1358s21c1
Sequence:CCGGAGCGCTGTGACTACATCTTTGCTCGAGCAAAGATGTAGTCACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1504s21c1
Sequence:CCGGACGGAGCTCAGCCAGATAAAGCTCGAGCTTTATCTGGCTGAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136103.1-3955s21c1
Sequence:CCGGATCCATTGTTTAAGTAGTAACCTCGAGGTTACTACTTAAACAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1326s21c1
Sequence:CCGGGTCCACAGACGAGGACGTTATCTCGAGATAACGTCCTCGTCTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136103
TMEM132C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1017s21c1
Sequence:CCGGCAACAGGAGCAGCAGTTTATTCTCGAGAATAAACTGCTGCTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1358s21c1
Sequence:CCGGAGCGCTGTGACTACATCTTTGCTCGAGCAAAGATGTAGTCACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1504s21c1
Sequence:CCGGACGGAGCTCAGCCAGATAAAGCTCGAGCTTTATCTGGCTGAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136103.1-3955s21c1
Sequence:CCGGATCCATTGTTTAAGTAGTAACCTCGAGGTTACTACTTAAACAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136103.1-1326s21c1
Sequence:CCGGGTCCACAGACGAGGACGTTATCTCGAGATAACGTCCTCGTCTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175432
TMEM132C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-1034s21c1
Sequence:CCGGATCTGTCACCATCGCCAATAACTCGAGTTATTGGCGATGGTGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-3067s21c1
Sequence:CCGGATGAGCACACGACCATCATAGCTCGAGCTATGATGGTCGTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-1221s21c1
Sequence:CCGGCGAAATAGGAGCAGCAATTTACTCGAGTAAATTGCTGCTCCTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175432.3-3802s21c1
Sequence:CCGGACAAATGACTGTCGGTTTATACTCGAGTATAAACCGACAGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-466s21c1
Sequence:CCGGTAGGCCCAACCAGTAAGTTTCCTCGAGGAAACTTACTGGTTGGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175432
TMEM132C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-1034s21c1
Sequence:CCGGATCTGTCACCATCGCCAATAACTCGAGTTATTGGCGATGGTGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-3067s21c1
Sequence:CCGGATGAGCACACGACCATCATAGCTCGAGCTATGATGGTCGTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-1221s21c1
Sequence:CCGGCGAAATAGGAGCAGCAATTTACTCGAGTAAATTGCTGCTCCTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175432.3-3802s21c1
Sequence:CCGGACAAATGACTGTCGGTTTATACTCGAGTATAAACCGACAGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-466s21c1
Sequence:CCGGTAGGCCCAACCAGTAAGTTTCCTCGAGGAAACTTACTGGTTGGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175432
TMEM132C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-1034s21c1
Sequence:CCGGATCTGTCACCATCGCCAATAACTCGAGTTATTGGCGATGGTGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-3067s21c1
Sequence:CCGGATGAGCACACGACCATCATAGCTCGAGCTATGATGGTCGTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-1221s21c1
Sequence:CCGGCGAAATAGGAGCAGCAATTTACTCGAGTAAATTGCTGCTCCTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175432.3-3802s21c1
Sequence:CCGGACAAATGACTGTCGGTTTATACTCGAGTATAAACCGACAGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175432.3-466s21c1
Sequence:CCGGTAGGCCCAACCAGTAAGTTTCCTCGAGGAAACTTACTGGTTGGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks