EMAIL THIS PAGE TO A FRIEND

TMEM132D

transmembrane protein 132D

Synonyms: MOLT
UniProtKB ID: Q14C87, Q14C96, Q76M59, Q8N1W9, Q8N3Q5, Q8TF57
Gene ID:
Mouse(243274) transmembrane protein 132D
Rat(288750) transmembrane protein 132D
chicken(416806) transmembrane protein 132D
domestic cat(101081417) transmembrane protein 132D
Horse(100147694) transmembrane protein 132D
dog(486233) transmembrane protein 132D
naked mole-rat(101708050) transmembrane protein 132D
Domestic Rabbit(100350610) transmembrane protein 132D
cow(100297935) transmembrane protein 132D
sheep(101114468) transmembrane protein 132D
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133448 Rosetta Predictions human pricing
NM_198727 Rosetta Predictions rat pricing
NM_172885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186807 predicted 3577
2 SASI_Hs01_00186808 predicted 3356
3 SASI_Hs01_00186810 predicted 2845
4 SASI_Hs01_00186811 predicted 2680
5 SASI_Hs01_00186812 predicted 2132
6 SASI_Hs01_00186813 predicted 2581
7 SASI_Hs01_00186814 predicted 3067
8 SASI_Hs01_00186816 predicted 663
9 SASI_Hs02_00363128 predicted 1770
10 SASI_Hs02_00363129 predicted 3130
11 SASI_Hs01_00186809 predicted 1815
12 SASI_Hs01_00186815 predicted 3083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087041 predicted 332
2 SASI_Rn01_00087042 predicted 1511
3 SASI_Rn01_00087043 predicted 2735
4 SASI_Rn01_00087044 predicted 1470
5 SASI_Rn01_00087045 predicted 238
6 SASI_Rn01_00087047 predicted 377
7 SASI_Rn01_00087048 predicted 3027
8 SASI_Rn01_00087049 predicted 1151
9 SASI_Rn02_00269931 predicted 3016
10 SASI_Rn01_00087050 predicted 2287
11 SASI_Rn01_00087046 predicted 2869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152475 predicted 2139
2 SASI_Mm01_00152476 predicted 815
3 SASI_Mm01_00152477 predicted 3664
4 SASI_Mm02_00344857 predicted 2157
5 SASI_Mm01_00152478 predicted 4007
6 SASI_Mm01_00152479 predicted 2518
7 SASI_Mm01_00152480 predicted 3902
8 SASI_Mm01_00152481 predicted 1801
9 SASI_Mm01_00152482 predicted 3981
10 SASI_Mm01_00152483 predicted 4035
11 SASI_Mm01_00152474 predicted 4023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133448
TMEM132D MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133448.2-3825s21c1
Sequence:CCGGTGTCTTGCTTAAGAGGTTTATCTCGAGATAAACCTCTTAAGCAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133448.2-3528s21c1
Sequence:CCGGTGAGTAGCGAGGATGACATTACTCGAGTAATGTCATCCTCGCTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133448.2-4037s21c1
Sequence:CCGGGATCGCATCCATGGATCAATGCTCGAGCATTGATCCATGGATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133448.1-5615s1c1
Sequence:CCGGGCTTTCAGTAACGTCCTCATACTCGAGTATGAGGACGTTACTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133448.1-5120s1c1
Sequence:CCGGGCTCACTCCAAGGTAGAGAATCTCGAGATTCTCTACCTTGGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-1370s1c1
Sequence:CCGGGCGCACGGATTATACTGGAAACTCGAGTTTCCAGTATAATCCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-649s1c1
Sequence:CCGGCCCAGGATTTAATGCTACCTTCTCGAGAAGGTAGCATTAAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133448.1-2695s1c1
Sequence:CCGGGAACGGCAAACATCAAAGTTACTCGAGTAACTTTGATGTTTGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-675s1c1
Sequence:CCGGCCATTTGGATTCACCAACAAACTCGAGTTTGTTGGTGAATCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133448.1-3131s1c1
Sequence:CCGGCTTGATAAACTGTGTGACCTTCTCGAGAAGGTCACACAGTTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133448
TMEM132D MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133448.2-3825s21c1
Sequence:CCGGTGTCTTGCTTAAGAGGTTTATCTCGAGATAAACCTCTTAAGCAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133448.2-3528s21c1
Sequence:CCGGTGAGTAGCGAGGATGACATTACTCGAGTAATGTCATCCTCGCTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133448.2-4037s21c1
Sequence:CCGGGATCGCATCCATGGATCAATGCTCGAGCATTGATCCATGGATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133448.1-5615s1c1
Sequence:CCGGGCTTTCAGTAACGTCCTCATACTCGAGTATGAGGACGTTACTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133448.1-5120s1c1
Sequence:CCGGGCTCACTCCAAGGTAGAGAATCTCGAGATTCTCTACCTTGGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-1370s1c1
Sequence:CCGGGCGCACGGATTATACTGGAAACTCGAGTTTCCAGTATAATCCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-649s1c1
Sequence:CCGGCCCAGGATTTAATGCTACCTTCTCGAGAAGGTAGCATTAAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133448.1-2695s1c1
Sequence:CCGGGAACGGCAAACATCAAAGTTACTCGAGTAACTTTGATGTTTGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-675s1c1
Sequence:CCGGCCATTTGGATTCACCAACAAACTCGAGTTTGTTGGTGAATCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133448.1-3131s1c1
Sequence:CCGGCTTGATAAACTGTGTGACCTTCTCGAGAAGGTCACACAGTTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133448
TMEM132D MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133448.2-3825s21c1
Sequence:CCGGTGTCTTGCTTAAGAGGTTTATCTCGAGATAAACCTCTTAAGCAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133448.2-3528s21c1
Sequence:CCGGTGAGTAGCGAGGATGACATTACTCGAGTAATGTCATCCTCGCTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133448.2-4037s21c1
Sequence:CCGGGATCGCATCCATGGATCAATGCTCGAGCATTGATCCATGGATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133448.1-5615s1c1
Sequence:CCGGGCTTTCAGTAACGTCCTCATACTCGAGTATGAGGACGTTACTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133448.1-5120s1c1
Sequence:CCGGGCTCACTCCAAGGTAGAGAATCTCGAGATTCTCTACCTTGGAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-1370s1c1
Sequence:CCGGGCGCACGGATTATACTGGAAACTCGAGTTTCCAGTATAATCCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-649s1c1
Sequence:CCGGCCCAGGATTTAATGCTACCTTCTCGAGAAGGTAGCATTAAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133448.1-2695s1c1
Sequence:CCGGGAACGGCAAACATCAAAGTTACTCGAGTAACTTTGATGTTTGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133448.1-675s1c1
Sequence:CCGGCCATTTGGATTCACCAACAAACTCGAGTTTGTTGGTGAATCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133448.1-3131s1c1
Sequence:CCGGCTTGATAAACTGTGTGACCTTCTCGAGAAGGTCACACAGTTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172885
TMEM132D MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132D
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.2-3908s1c1
Sequence:CCGGGAGTAATGAGGATGACATTAACTCGAGTTAATGTCATCCTCATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.2-3079s1c1
Sequence:CCGGCAGCCAGCATCAAGGTTAAATCTCGAGATTTAACCTTGATGCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.1-1503s1c1
Sequence:CCGGGCATAGAATTGGGAGCGTCTTCTCGAGAAGACGCTCCCAATTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172885.1-1785s1c1
Sequence:CCGGCGTCATCGTTTGTCAGAAGAACTCGAGTTCTTCTGACAAACGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.1-1056s1c1
Sequence:CCGGCAACCCATTTGGATTCACTAACTCGAGTTAGTGAATCCAAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172885.1-4025s1c1
Sequence:CCGGGTTCTTACCTTTCAGCCTTTACTCGAGTAAAGGCTGAAAGGTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172885.1-1034s1c1
Sequence:CCGGCCCAGGATTTGATGTTGCCTTCTCGAGAAGGCAACATCAAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172885.1-4033s1c1
Sequence:CCGGCTTTCAGCCTTTAACCCACTTCTCGAGAAGTGGGTTAAAGGCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172885
TMEM132D MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132D
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.2-3908s1c1
Sequence:CCGGGAGTAATGAGGATGACATTAACTCGAGTTAATGTCATCCTCATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.2-3079s1c1
Sequence:CCGGCAGCCAGCATCAAGGTTAAATCTCGAGATTTAACCTTGATGCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.1-1503s1c1
Sequence:CCGGGCATAGAATTGGGAGCGTCTTCTCGAGAAGACGCTCCCAATTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172885.1-1785s1c1
Sequence:CCGGCGTCATCGTTTGTCAGAAGAACTCGAGTTCTTCTGACAAACGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.1-1056s1c1
Sequence:CCGGCAACCCATTTGGATTCACTAACTCGAGTTAGTGAATCCAAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172885.1-4025s1c1
Sequence:CCGGGTTCTTACCTTTCAGCCTTTACTCGAGTAAAGGCTGAAAGGTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172885.1-1034s1c1
Sequence:CCGGCCCAGGATTTGATGTTGCCTTCTCGAGAAGGCAACATCAAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172885.1-4033s1c1
Sequence:CCGGCTTTCAGCCTTTAACCCACTTCTCGAGAAGTGGGTTAAAGGCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172885
TMEM132D MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132D
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.2-3908s1c1
Sequence:CCGGGAGTAATGAGGATGACATTAACTCGAGTTAATGTCATCCTCATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.2-3079s1c1
Sequence:CCGGCAGCCAGCATCAAGGTTAAATCTCGAGATTTAACCTTGATGCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.1-1503s1c1
Sequence:CCGGGCATAGAATTGGGAGCGTCTTCTCGAGAAGACGCTCCCAATTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172885.1-1785s1c1
Sequence:CCGGCGTCATCGTTTGTCAGAAGAACTCGAGTTCTTCTGACAAACGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172885.1-1056s1c1
Sequence:CCGGCAACCCATTTGGATTCACTAACTCGAGTTAGTGAATCCAAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172885.1-4025s1c1
Sequence:CCGGGTTCTTACCTTTCAGCCTTTACTCGAGTAAAGGCTGAAAGGTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172885.1-1034s1c1
Sequence:CCGGCCCAGGATTTGATGTTGCCTTCTCGAGAAGGCAACATCAAATCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172885.1-4033s1c1
Sequence:CCGGCTTTCAGCCTTTAACCCACTTCTCGAGAAGTGGGTTAAAGGCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks