EMAIL THIS PAGE TO A FRIEND

TMEM132E

transmembrane protein 132E

UniProtKB ID: Q6IEE7, Q8WUF4, Q8WVA5
Gene ID:
Mouse(270893) transmembrane protein 132E
Rat(287564) transmembrane protein 132E
cow(506723) transmembrane protein 132E
sheep(101114122) transmembrane protein 132E
Domestic Rabbit(100357167) transmembrane protein 132E
naked mole-rat(101725281) transmembrane protein 132E
domestic guinea pig(100717271) transmembrane protein 132E
Zebrafish(564044) transmembrane protein 132E
domestic cat(101100261) transmembrane protein 132E
dog(491147) transmembrane protein 132E
chicken(771389) transmembrane protein 132E
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207313 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207313 Rosetta Predictions human pricing
NM_001134410 Rosetta Predictions rat pricing
NM_023438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135214 predicted 1451
2 SASI_Hs01_00135215 predicted 1276
3 SASI_Hs01_00135216 predicted 1414
4 SASI_Hs01_00135217 predicted 3549
5 SASI_Hs01_00135218 predicted 1263
6 SASI_Hs01_00135219 predicted 2765
7 SASI_Hs01_00135220 predicted 1064
8 SASI_Hs01_00135221 predicted 2282
9 SASI_Hs02_00373845 predicted 2295
10 SASI_Hs02_00373846 predicted 1215
11 SASI_Hs01_00135213 predicted 3726
12 SASI_Hs01_00135222 predicted 3736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256249 predicted 1188
2 SASI_Rn02_00256250 predicted 971
3 SASI_Rn02_00256251 predicted 1346
4 SASI_Rn02_00256252 predicted 944
5 SASI_Rn02_00256253 predicted 2205
6 SASI_Rn02_00256254 predicted 1361
7 SASI_Rn02_00256255 predicted 1006
8 SASI_Rn02_00256256 predicted 3215
9 SASI_Rn02_00256257 predicted 3170
10 SASI_Rn02_00256258 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092486 predicted 1093
2 SASI_Mm01_00092487 predicted 2582
3 SASI_Mm01_00092488 predicted 2603
4 SASI_Mm01_00092489 predicted 3076
5 SASI_Mm01_00092490 predicted 264
6 SASI_Mm01_00092491 predicted 2213
7 SASI_Mm01_00092493 predicted 880
8 SASI_Mm01_00092494 predicted 1273
9 SASI_Mm01_00092495 predicted 1188
10 SASI_Mm02_00327119 predicted 3125
11 SASI_Mm01_00092492 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023438
TMEM132E MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-267s1c1
Sequence:CCGGCCCTATACTACCGGTTAGCTACTCGAGTAGCTAACCGGTAGTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-861s1c1
Sequence:CCGGGCACTTCACACTTAGGGTGAACTCGAGTTCACCCTAAGTGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023438.2-3339s1c1
Sequence:CCGGCCTTTCCAAATCTCATTCCATCTCGAGATGGAATGAGATTTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-3060s1c1
Sequence:CCGGGCACAATTATATGCGCAGAATCTCGAGATTCTGCGCATATAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-1053s1c1
Sequence:CCGGGCTAGACTTTGAGATGGAGAACTCGAGTTCTCCATCTCAAAGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023438
TMEM132E MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-267s1c1
Sequence:CCGGCCCTATACTACCGGTTAGCTACTCGAGTAGCTAACCGGTAGTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-861s1c1
Sequence:CCGGGCACTTCACACTTAGGGTGAACTCGAGTTCACCCTAAGTGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023438.2-3339s1c1
Sequence:CCGGCCTTTCCAAATCTCATTCCATCTCGAGATGGAATGAGATTTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-3060s1c1
Sequence:CCGGGCACAATTATATGCGCAGAATCTCGAGATTCTGCGCATATAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-1053s1c1
Sequence:CCGGGCTAGACTTTGAGATGGAGAACTCGAGTTCTCCATCTCAAAGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023438
TMEM132E MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-267s1c1
Sequence:CCGGCCCTATACTACCGGTTAGCTACTCGAGTAGCTAACCGGTAGTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-861s1c1
Sequence:CCGGGCACTTCACACTTAGGGTGAACTCGAGTTCACCCTAAGTGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023438.2-3339s1c1
Sequence:CCGGCCTTTCCAAATCTCATTCCATCTCGAGATGGAATGAGATTTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-3060s1c1
Sequence:CCGGGCACAATTATATGCGCAGAATCTCGAGATTCTGCGCATATAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023438.2-1053s1c1
Sequence:CCGGGCTAGACTTTGAGATGGAGAACTCGAGTTCTCCATCTCAAAGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207313
TMEM132E MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 132E
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000434914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-1443s21c1
Sequence:CCGGCCATCCCTGTCAAGGTCATTGCTCGAGCAATGACCTTGACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-1548s21c1
Sequence:CCGGGCAGCTGTGACTACGTGTTTGCTCGAGCAAACACGTAGTCACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-2286s21c1
Sequence:CCGGTCTACAGCCCACGAGACTATGCTCGAGCATAGTCTCGTGGGCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207313
TMEM132E MISSION shRNA shRNA Plasmid DNA
transmembrane protein 132E
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000434914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-1443s21c1
Sequence:CCGGCCATCCCTGTCAAGGTCATTGCTCGAGCAATGACCTTGACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-1548s21c1
Sequence:CCGGGCAGCTGTGACTACGTGTTTGCTCGAGCAAACACGTAGTCACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-2286s21c1
Sequence:CCGGTCTACAGCCCACGAGACTATGCTCGAGCATAGTCTCGTGGGCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207313
TMEM132E MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 132E
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000434914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-1443s21c1
Sequence:CCGGCCATCCCTGTCAAGGTCATTGCTCGAGCAATGACCTTGACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-1548s21c1
Sequence:CCGGGCAGCTGTGACTACGTGTTTGCTCGAGCAAACACGTAGTCACAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207313.1-2286s21c1
Sequence:CCGGTCTACAGCCCACGAGACTATGCTCGAGCATAGTCTCGTGGGCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks