EMAIL THIS PAGE TO A FRIEND

TMEM133

transmembrane protein 133

Species: Human TMEM133(83935)
UniProtKB ID: Q9H2Q1
Gene ID:
Human(83935) Summary: There is evidence that this intronless gene is transcribed but the protein is predicted. The gene function is unknown. [provided by RefSeq, Jul 2008]
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032021 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009761 MISSION® esiRNA esiRNA targeting human TMEM133 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032021 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144989 predicted 285
2 SASI_Hs01_00144990 predicted 299
3 SASI_Hs01_00144996 predicted 288
4 SASI_Hs01_00144991 predicted 957
5 SASI_Hs02_00359203 predicted 291
6 SASI_Hs02_00359204 predicted 981
7 SASI_Hs02_00359205 predicted 238
8 SASI_Hs02_00359206 predicted 896
9 SASI_Hs02_00359207 predicted 953
10 SASI_Hs01_00144992 predicted 882
11 SASI_Hs01_00144993 predicted 346
12 SASI_Hs01_00144994 predicted 253
13 SASI_Hs01_00144995 predicted 572
14 SASI_Hs01_00144997 predicted 536
15 SASI_Hs01_00144998 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032021
TMEM133 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 133
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032021.2-571s21c1
Sequence:CCGGGCCAGTTCCACTTGGTAATAACTCGAGTTATTACCAAGTGGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032021.2-935s21c1
Sequence:CCGGTTCATTTACTGCCATCATAAACTCGAGTTTATGATGGCAGTAAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032021.2-487s1c1
Sequence:CCGGCGAGTATTCATCAACTGGTCTCTCGAGAGACCAGTTGATGAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-504s1c1
Sequence:CCGGGTCTCAATTTCCTGAACACATCTCGAGATGTGTTCAGGAAATTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-361s1c1
Sequence:CCGGGCTATTTAACTTTGCCTCCTACTCGAGTAGGAGGCAAAGTTAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-490s1c1
Sequence:CCGGGTATTCATCAACTGGTCTCAACTCGAGTTGAGACCAGTTGATGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-520s1c1
Sequence:CCGGCACATTCACTGTATCCCTCATCTCGAGATGAGGGATACAGTGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-463s1c1
Sequence:CCGGCCTGTTGATTCGCAGATGTAACTCGAGTTACATCTGCGAATCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032021
TMEM133 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 133
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032021.2-571s21c1
Sequence:CCGGGCCAGTTCCACTTGGTAATAACTCGAGTTATTACCAAGTGGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032021.2-935s21c1
Sequence:CCGGTTCATTTACTGCCATCATAAACTCGAGTTTATGATGGCAGTAAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032021.2-487s1c1
Sequence:CCGGCGAGTATTCATCAACTGGTCTCTCGAGAGACCAGTTGATGAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-504s1c1
Sequence:CCGGGTCTCAATTTCCTGAACACATCTCGAGATGTGTTCAGGAAATTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-361s1c1
Sequence:CCGGGCTATTTAACTTTGCCTCCTACTCGAGTAGGAGGCAAAGTTAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-490s1c1
Sequence:CCGGGTATTCATCAACTGGTCTCAACTCGAGTTGAGACCAGTTGATGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-520s1c1
Sequence:CCGGCACATTCACTGTATCCCTCATCTCGAGATGAGGGATACAGTGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-463s1c1
Sequence:CCGGCCTGTTGATTCGCAGATGTAACTCGAGTTACATCTGCGAATCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032021
TMEM133 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 133
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032021.2-571s21c1
Sequence:CCGGGCCAGTTCCACTTGGTAATAACTCGAGTTATTACCAAGTGGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032021.2-935s21c1
Sequence:CCGGTTCATTTACTGCCATCATAAACTCGAGTTTATGATGGCAGTAAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032021.2-487s1c1
Sequence:CCGGCGAGTATTCATCAACTGGTCTCTCGAGAGACCAGTTGATGAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-504s1c1
Sequence:CCGGGTCTCAATTTCCTGAACACATCTCGAGATGTGTTCAGGAAATTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-361s1c1
Sequence:CCGGGCTATTTAACTTTGCCTCCTACTCGAGTAGGAGGCAAAGTTAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-490s1c1
Sequence:CCGGGTATTCATCAACTGGTCTCAACTCGAGTTGAGACCAGTTGATGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-520s1c1
Sequence:CCGGCACATTCACTGTATCCCTCATCTCGAGATGAGGGATACAGTGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032021.2-463s1c1
Sequence:CCGGCCTGTTGATTCGCAGATGTAACTCGAGTTACATCTGCGAATCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks