EMAIL THIS PAGE TO A FRIEND

TMEM134

transmembrane protein 134

UniProtKB ID: Q9H6X4, Q08AK4, Q6PJN3
Gene ID:
Mouse(66990) transmembrane protein 134
Rat(361695) transmembrane protein 134
Zebrafish(393340) transmembrane protein 134
dog(610471) transmembrane protein 134
domestic cat(101081673) transmembrane protein 134
domestic guinea pig(100723256) transmembrane protein 134
naked mole-rat(101701019) transmembrane protein 134
cow(510129) transmembrane protein 134
sheep(101110633) transmembrane protein 134
Goat(100861128) transmembrane protein 134
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001078650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001078650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001078650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078650 Rosetta Predictions human pricing
NM_001078651 Rosetta Predictions human pricing
NM_025124 Rosetta Predictions human pricing
NM_001078647 Rosetta Predictions rat pricing
NM_001078648 Rosetta Predictions rat pricing
NM_001078649 Rosetta Predictions mouse pricing
NM_025889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313349 predicted 523
2 SASI_Hs02_00313350 predicted 396
3 SASI_Hs02_00313351 predicted 394
4 SASI_Hs02_00313352 predicted 469
5 SASI_Hs02_00313353 predicted 302
6 SASI_Hs02_00313354 predicted 400
7 SASI_Hs02_00313355 predicted 400
8 SASI_Hs02_00313356 predicted 508
9 SASI_Hs02_00313357 predicted 400
10 SASI_Hs02_00313358 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313359 predicted 543
2 SASI_Hs02_00313360 predicted 540
3 SASI_Hs02_00313361 predicted 537
4 SASI_Hs02_00313362 predicted 534
5 SASI_Hs02_00313363 predicted 527
6 SASI_Hs02_00313364 predicted 549
7 SASI_Hs02_00313365 predicted 668
8 SASI_Hs02_00313366 predicted 600
9 SASI_Hs02_00313367 predicted 604
10 SASI_Hs02_00313368 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357819 predicted 568
2 SASI_Hs01_00167135 predicted 562
3 SASI_Hs02_00357820 predicted 562
4 SASI_Hs02_00357821 predicted 563
5 SASI_Hs01_00167142 predicted 559
6 SASI_Hs02_00357822 predicted 571
7 SASI_Hs02_00357823 predicted 697
8 SASI_Hs02_00357824 predicted 632
9 SASI_Hs02_00357825 predicted 633
10 SASI_Hs02_00357826 predicted 532
11 SASI_Hs01_00167136 predicted 434
12 SASI_Hs01_00167137 predicted 433
13 SASI_Hs01_00167138 predicted 338
14 SASI_Hs01_00167139 predicted 551
15 SASI_Hs01_00167140 predicted 439
16 SASI_Hs01_00167141 predicted 436
17 SASI_Hs01_00167143 predicted 271
18 SASI_Hs01_00167144 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207969 predicted 370
2 SASI_Rn02_00207970 predicted 375
3 SASI_Rn02_00207971 predicted 486
4 SASI_Rn02_00207972 predicted 535
5 SASI_Rn02_00207973 predicted 529
6 SASI_Rn02_00207974 predicted 489
7 SASI_Rn02_00207975 predicted 683
8 SASI_Rn02_00207976 predicted 430
9 SASI_Rn02_00207977 predicted 402
10 SASI_Rn02_00207978 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207979 predicted 365
2 SASI_Rn02_00207980 predicted 372
3 SASI_Rn02_00207981 predicted 369
4 SASI_Rn02_00207982 predicted 491
5 SASI_Rn02_00207983 predicted 488
6 SASI_Rn02_00207984 predicted 634
7 SASI_Rn02_00207985 predicted 404
8 SASI_Rn02_00207986 predicted 504
9 SASI_Rn02_00207987 predicted 483
10 SASI_Rn02_00207988 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292992 predicted 1026
2 SASI_Mm02_00292993 predicted 830
3 SASI_Mm02_00292994 predicted 866
4 SASI_Mm02_00292995 predicted 866
5 SASI_Mm02_00292996 predicted 835
6 SASI_Mm02_00292997 predicted 916
7 SASI_Mm02_00292998 predicted 939
8 SASI_Mm02_00292999 predicted 887
9 SASI_Mm02_00293000 predicted 709
10 SASI_Mm02_00293001 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070414 predicted 987
2 SASI_Mm02_00329226 predicted 788
3 SASI_Mm01_00070417 predicted 821
4 SASI_Mm02_00329227 predicted 823
5 SASI_Mm01_00070418 predicted 792
6 SASI_Mm01_00070420 predicted 877
7 SASI_Mm02_00329228 predicted 894
8 SASI_Mm02_00329229 predicted 835
9 SASI_Mm02_00329230 predicted 799
10 SASI_Mm02_00329231 predicted 769
11 SASI_Mm01_00070413 predicted 380
12 SASI_Mm01_00070415 predicted 284
13 SASI_Mm01_00070416 predicted 504
14 SASI_Mm01_00070419 predicted 489
15 SASI_Mm01_00070421 predicted 405
16 SASI_Mm01_00070422 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025889
VALIDATED
TMEM134 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 134
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025889.1-795s1c1
Sequence:CCGGGCCTTAACTTATTCCTGGGTTCTCGAGAACCCAGGAATAAGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-504s1c1
Sequence:CCGGCTACCATGTGATCTTCATCTACTCGAGTAGATGAAGATCACATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-377s1c1
Sequence:CCGGCCCAACATCCTTTGATCCAGACTCGAGTCTGGATCAAAGGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-169s1c1
Sequence:CCGGCGGTTCGAGGTGGCTGATGAACTCGAGTTCATCAGCCACCTCGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-378s1c1
Sequence:CCGGCCAACATCCTTTGATCCAGAACTCGAGTTCTGGATCAAAGGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025889.2-1045s21c1
Sequence:CCGGGTGCCCATGGTCACCATTATGCTCGAGCATAATGGTGACCATGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-528s21c1
Sequence:CCGGCTACCATGTGATCTTCATCTACTCGAGTAGATGAAGATCACATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-581s21c1
Sequence:CCGGTCTTCTACCTGCCCTACTTTGCTCGAGCAAAGTAGGGCAGGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-473s21c1
Sequence:CCGGGTGTCTCCAGTGCCATCTTCTCTCGAGAGAAGATGGCACTGGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-95s21c1
Sequence:CCGGTCGATGATGCCTTCGAGCTGACTCGAGTCAGCTCGAAGGCATCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025889
VALIDATED
TMEM134 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 134
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025889.1-795s1c1
Sequence:CCGGGCCTTAACTTATTCCTGGGTTCTCGAGAACCCAGGAATAAGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-504s1c1
Sequence:CCGGCTACCATGTGATCTTCATCTACTCGAGTAGATGAAGATCACATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-377s1c1
Sequence:CCGGCCCAACATCCTTTGATCCAGACTCGAGTCTGGATCAAAGGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-169s1c1
Sequence:CCGGCGGTTCGAGGTGGCTGATGAACTCGAGTTCATCAGCCACCTCGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-378s1c1
Sequence:CCGGCCAACATCCTTTGATCCAGAACTCGAGTTCTGGATCAAAGGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025889.2-1045s21c1
Sequence:CCGGGTGCCCATGGTCACCATTATGCTCGAGCATAATGGTGACCATGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-528s21c1
Sequence:CCGGCTACCATGTGATCTTCATCTACTCGAGTAGATGAAGATCACATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-581s21c1
Sequence:CCGGTCTTCTACCTGCCCTACTTTGCTCGAGCAAAGTAGGGCAGGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-473s21c1
Sequence:CCGGGTGTCTCCAGTGCCATCTTCTCTCGAGAGAAGATGGCACTGGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-95s21c1
Sequence:CCGGTCGATGATGCCTTCGAGCTGACTCGAGTCAGCTCGAAGGCATCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025889
VALIDATED
TMEM134 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 134
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025889.1-795s1c1
Sequence:CCGGGCCTTAACTTATTCCTGGGTTCTCGAGAACCCAGGAATAAGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-504s1c1
Sequence:CCGGCTACCATGTGATCTTCATCTACTCGAGTAGATGAAGATCACATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-377s1c1
Sequence:CCGGCCCAACATCCTTTGATCCAGACTCGAGTCTGGATCAAAGGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-169s1c1
Sequence:CCGGCGGTTCGAGGTGGCTGATGAACTCGAGTTCATCAGCCACCTCGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025889.1-378s1c1
Sequence:CCGGCCAACATCCTTTGATCCAGAACTCGAGTTCTGGATCAAAGGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025889.2-1045s21c1
Sequence:CCGGGTGCCCATGGTCACCATTATGCTCGAGCATAATGGTGACCATGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-528s21c1
Sequence:CCGGCTACCATGTGATCTTCATCTACTCGAGTAGATGAAGATCACATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-581s21c1
Sequence:CCGGTCTTCTACCTGCCCTACTTTGCTCGAGCAAAGTAGGGCAGGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-473s21c1
Sequence:CCGGGTGTCTCCAGTGCCATCTTCTCTCGAGAGAAGATGGCACTGGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025889.2-95s21c1
Sequence:CCGGTCGATGATGCCTTCGAGCTGACTCGAGTCAGCTCGAAGGCATCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001078650
TMEM134 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 134
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-587s21c1
Sequence:CCGGCTACCTGCCCTACTTCGAGAACTCGAGTTCTCGAAGTAGGGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-542s21c1
Sequence:CCGGCTTCATCTACTGCGCGGTCAACTCGAGTTGACCGCGCAGTAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-404s21c1
Sequence:CCGGCCAACACCCTTTGATCCAGAACTCGAGTTCTGGATCAAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-514s21c1
Sequence:CCGGTGTTGGTGCCTGGAGTCTATCCTCGAGGATAGACTCCAGGCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-239s21c1
Sequence:CCGGCCAGAACCTGGAGAACGATGACTCGAGTCATCGTTCTCCAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001078650
TMEM134 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 134
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-587s21c1
Sequence:CCGGCTACCTGCCCTACTTCGAGAACTCGAGTTCTCGAAGTAGGGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-542s21c1
Sequence:CCGGCTTCATCTACTGCGCGGTCAACTCGAGTTGACCGCGCAGTAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-404s21c1
Sequence:CCGGCCAACACCCTTTGATCCAGAACTCGAGTTCTGGATCAAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-514s21c1
Sequence:CCGGTGTTGGTGCCTGGAGTCTATCCTCGAGGATAGACTCCAGGCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-239s21c1
Sequence:CCGGCCAGAACCTGGAGAACGATGACTCGAGTCATCGTTCTCCAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001078650
TMEM134 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 134
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-587s21c1
Sequence:CCGGCTACCTGCCCTACTTCGAGAACTCGAGTTCTCGAAGTAGGGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-542s21c1
Sequence:CCGGCTTCATCTACTGCGCGGTCAACTCGAGTTGACCGCGCAGTAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-404s21c1
Sequence:CCGGCCAACACCCTTTGATCCAGAACTCGAGTTCTGGATCAAAGGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-514s21c1
Sequence:CCGGTGTTGGTGCCTGGAGTCTATCCTCGAGGATAGACTCCAGGCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078650.1-239s21c1
Sequence:CCGGCCAGAACCTGGAGAACGATGACTCGAGTCATCGTTCTCCAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks