EMAIL THIS PAGE TO A FRIEND

TMEM135

transmembrane protein 135

Synonyms: PMP52
UniProtKB ID: Q86UB9, Q6AW91, Q8ND01, Q9H6M3
Gene ID:
Mouse(72759) transmembrane protein 135
Rat(293098) transmembrane protein 135
cow(523885) transmembrane protein 135
sheep(101123334) transmembrane protein 135
naked mole-rat(101699812) transmembrane protein 135
Domestic Rabbit(100341402) transmembrane protein 135
domestic guinea pig(100727937) transmembrane protein 135
Zebrafish(568244) transmembrane protein 135
Horse(100060782) transmembrane protein 135
domestic cat(101093043) transmembrane protein 135
chicken(419015) transmembrane protein 135
dog(607444) transmembrane protein 135
206 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108730 Anti-TMEM135 affinity isolated antibody bovine, guinea pig, pig, rat, human, horse, rabbit, bovine, mouse
immunohistochemistry, western blot pricing
SAB2102454 Anti-TMEM135 antibody produced in rabbit affinity isolated antibody bovine, human, rat, canine, guinea pig, horse, mouse, rabbit
western blot pricing
SAB3500832 Anti-TMEM135 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA069473 Anti-TMEM135 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA056685 Anti-TMEM135 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022918 Rosetta Predictions human pricing
NM_001013896 Rosetta Predictions rat pricing
NM_028343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159707 predicted 1068
2 SASI_Hs02_00356246 predicted 697
3 SASI_Hs01_00159709 predicted 672
4 SASI_Hs01_00159710 predicted 344
5 SASI_Hs01_00159711 predicted 1369
6 SASI_Hs01_00159712 predicted 938
7 SASI_Hs02_00356247 predicted 1485
8 SASI_Hs02_00356248 predicted 737
9 SASI_Hs02_00356249 predicted 754
10 SASI_Hs01_00159714 predicted 1058
11 SASI_Hs01_00159708 predicted 229
12 SASI_Hs01_00159713 predicted 1152
13 SASI_Hs01_00159715 predicted 993
14 SASI_Hs01_00159716 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034502 predicted 494
2 SASI_Rn01_00034504 predicted 939
3 SASI_Rn01_00034505 predicted 735
4 SASI_Rn01_00034506 predicted 1544
5 SASI_Rn01_00034507 predicted 1574
6 SASI_Rn01_00034508 predicted 895
7 SASI_Rn01_00034509 predicted 324
8 SASI_Rn01_00034510 predicted 487
9 SASI_Rn01_00034511 predicted 1444
10 SASI_Rn02_00201175 predicted 1284
11 SASI_Rn01_00034503 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049993 predicted 1142
2 SASI_Mm01_00049994 predicted 755
3 SASI_Mm01_00049995 predicted 1424
4 SASI_Mm01_00049996 predicted 1295
5 SASI_Mm01_00049997 predicted 831
6 SASI_Mm01_00049998 predicted 1381
7 SASI_Mm01_00049999 predicted 1083
8 SASI_Mm01_00050000 predicted 333
9 SASI_Mm02_00333712 predicted 753
10 SASI_Mm01_00050001 predicted 237
11 SASI_Mm01_00050002 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028343
VALIDATED
TMEM135 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 135
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-1151s21c1
Sequence:CCGGCTATTCCATCTCTACAGCAATCTCGAGATTGCTGTAGAGATGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-1134s21c1
Sequence:CCGGCAAGCAGATACGATCATCTATCTCGAGATAGATGATCGTATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-657s21c1
Sequence:CCGGCCGAGAGCAATGAGCATAATCCTCGAGGATTATGCTCATTGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028343.3-515s1c1
Sequence:CCGGCAGGTGCAAAGATGGCTTAAACTCGAGTTTAAGCCATCTTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028343.3-1539s21c1
Sequence:CCGGTAGAAAGGCGTTGCTTAATAACTCGAGTTATTAAGCAACGCCTTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028343.2-3273s1c1
Sequence:CCGGGCTACCATGAAAGAGAACATACTCGAGTATGTTCTCTTTCATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-407s1c1
Sequence:CCGGCCACAGAAACACTATTTAGAACTCGAGTTCTAAATAGTGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-1152s1c1
Sequence:CCGGCTATTCCATCTCTACAGCAATCTCGAGATTGCTGTAGAGATGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-1135s1c1
Sequence:CCGGCAAGCAGATACGATCATCTATCTCGAGATAGATGATCGTATCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028343.2-2808s1c1
Sequence:CCGGCCACTTGAGTTTGCTCAGAATCTCGAGATTCTGAGCAAACTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028343.2-1899s1c1
Sequence:CCGGGCCATTCTTATTTCAGGGATACTCGAGTATCCCTGAAATAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028343
VALIDATED
TMEM135 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 135
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-1151s21c1
Sequence:CCGGCTATTCCATCTCTACAGCAATCTCGAGATTGCTGTAGAGATGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-1134s21c1
Sequence:CCGGCAAGCAGATACGATCATCTATCTCGAGATAGATGATCGTATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-657s21c1
Sequence:CCGGCCGAGAGCAATGAGCATAATCCTCGAGGATTATGCTCATTGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028343.3-515s1c1
Sequence:CCGGCAGGTGCAAAGATGGCTTAAACTCGAGTTTAAGCCATCTTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028343.3-1539s21c1
Sequence:CCGGTAGAAAGGCGTTGCTTAATAACTCGAGTTATTAAGCAACGCCTTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028343.2-3273s1c1
Sequence:CCGGGCTACCATGAAAGAGAACATACTCGAGTATGTTCTCTTTCATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-407s1c1
Sequence:CCGGCCACAGAAACACTATTTAGAACTCGAGTTCTAAATAGTGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-1152s1c1
Sequence:CCGGCTATTCCATCTCTACAGCAATCTCGAGATTGCTGTAGAGATGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-1135s1c1
Sequence:CCGGCAAGCAGATACGATCATCTATCTCGAGATAGATGATCGTATCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028343.2-2808s1c1
Sequence:CCGGCCACTTGAGTTTGCTCAGAATCTCGAGATTCTGAGCAAACTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028343.2-1899s1c1
Sequence:CCGGGCCATTCTTATTTCAGGGATACTCGAGTATCCCTGAAATAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028343
VALIDATED
TMEM135 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 135
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-1151s21c1
Sequence:CCGGCTATTCCATCTCTACAGCAATCTCGAGATTGCTGTAGAGATGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-1134s21c1
Sequence:CCGGCAAGCAGATACGATCATCTATCTCGAGATAGATGATCGTATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028343.3-657s21c1
Sequence:CCGGCCGAGAGCAATGAGCATAATCCTCGAGGATTATGCTCATTGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028343.3-515s1c1
Sequence:CCGGCAGGTGCAAAGATGGCTTAAACTCGAGTTTAAGCCATCTTTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028343.3-1539s21c1
Sequence:CCGGTAGAAAGGCGTTGCTTAATAACTCGAGTTATTAAGCAACGCCTTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028343.2-3273s1c1
Sequence:CCGGGCTACCATGAAAGAGAACATACTCGAGTATGTTCTCTTTCATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-407s1c1
Sequence:CCGGCCACAGAAACACTATTTAGAACTCGAGTTCTAAATAGTGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-1152s1c1
Sequence:CCGGCTATTCCATCTCTACAGCAATCTCGAGATTGCTGTAGAGATGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028343.2-1135s1c1
Sequence:CCGGCAAGCAGATACGATCATCTATCTCGAGATAGATGATCGTATCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193771    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028343.2-2808s1c1
Sequence:CCGGCCACTTGAGTTTGCTCAGAATCTCGAGATTCTGAGCAAACTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028343.2-1899s1c1
Sequence:CCGGGCCATTCTTATTTCAGGGATACTCGAGTATCCCTGAAATAAGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022918
VALIDATED
TMEM135 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 135
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-225s21c1
Sequence:CCGGATCCTACAATCCGCTTCATTTCTCGAGAAATGAAGCGGATTGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-1150s21c1
Sequence:CCGGATGCAGATACTATCATCTATTCTCGAGAATAGATGATAGTATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022918.2-174s21c1
Sequence:CCGGATTCTCCGGAAACGGAAATTACTCGAGTAATTTCCGTTTCCGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-1915s21c1
Sequence:CCGGGCTTTCGTGTAGAGCAATTTACTCGAGTAAATTGCTCTACACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022918.2-2925s1c1
Sequence:CCGGGCTTTGTAGAACTGACCTGTTCTCGAGAACAGGTCAGTTCTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022918.2-1223s1c1
Sequence:CCGGGAGACCATCTTACTGGAAGTTCTCGAGAACTTCCAGTAAGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022918.2-2886s1c1
Sequence:CCGGGCCACTTTATCATTTGGTCAACTCGAGTTGACCAAATGATAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022918.2-2076s1c1
Sequence:CCGGCCAGTGAACCTATGTACTAATCTCGAGATTAGTACATAGGTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022918.2-1314s1c1
Sequence:CCGGGCATCTAAACACTTTCAGGATCTCGAGATCCTGAAAGTGTTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022918.2-2084s1c1
Sequence:CCGGCCTATGTACTAATGGCAAGTTCTCGAGAACTTGCCATTAGTACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022918.2-140s1c1
Sequence:CCGGGAAGATCTATGCTCCTCTGTACTCGAGTACAGAGGAGCATAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022918.2-1915s1c1
Sequence:CCGGGCTTTCGTGTAGAGCAATTTACTCGAGTAAATTGCTCTACACGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022918
VALIDATED
TMEM135 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 135
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-225s21c1
Sequence:CCGGATCCTACAATCCGCTTCATTTCTCGAGAAATGAAGCGGATTGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-1150s21c1
Sequence:CCGGATGCAGATACTATCATCTATTCTCGAGAATAGATGATAGTATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022918.2-174s21c1
Sequence:CCGGATTCTCCGGAAACGGAAATTACTCGAGTAATTTCCGTTTCCGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-1915s21c1
Sequence:CCGGGCTTTCGTGTAGAGCAATTTACTCGAGTAAATTGCTCTACACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022918.2-2925s1c1
Sequence:CCGGGCTTTGTAGAACTGACCTGTTCTCGAGAACAGGTCAGTTCTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022918.2-1223s1c1
Sequence:CCGGGAGACCATCTTACTGGAAGTTCTCGAGAACTTCCAGTAAGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022918.2-2886s1c1
Sequence:CCGGGCCACTTTATCATTTGGTCAACTCGAGTTGACCAAATGATAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022918.2-2076s1c1
Sequence:CCGGCCAGTGAACCTATGTACTAATCTCGAGATTAGTACATAGGTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022918.2-1314s1c1
Sequence:CCGGGCATCTAAACACTTTCAGGATCTCGAGATCCTGAAAGTGTTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022918.2-2084s1c1
Sequence:CCGGCCTATGTACTAATGGCAAGTTCTCGAGAACTTGCCATTAGTACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022918.2-140s1c1
Sequence:CCGGGAAGATCTATGCTCCTCTGTACTCGAGTACAGAGGAGCATAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022918.2-1915s1c1
Sequence:CCGGGCTTTCGTGTAGAGCAATTTACTCGAGTAAATTGCTCTACACGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022918
VALIDATED
TMEM135 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 135
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-225s21c1
Sequence:CCGGATCCTACAATCCGCTTCATTTCTCGAGAAATGAAGCGGATTGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-1150s21c1
Sequence:CCGGATGCAGATACTATCATCTATTCTCGAGAATAGATGATAGTATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022918.2-174s21c1
Sequence:CCGGATTCTCCGGAAACGGAAATTACTCGAGTAATTTCCGTTTCCGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022918.2-1915s21c1
Sequence:CCGGGCTTTCGTGTAGAGCAATTTACTCGAGTAAATTGCTCTACACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022918.2-2925s1c1
Sequence:CCGGGCTTTGTAGAACTGACCTGTTCTCGAGAACAGGTCAGTTCTACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022918.2-1223s1c1
Sequence:CCGGGAGACCATCTTACTGGAAGTTCTCGAGAACTTCCAGTAAGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022918.2-2886s1c1
Sequence:CCGGGCCACTTTATCATTTGGTCAACTCGAGTTGACCAAATGATAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022918.2-2076s1c1
Sequence:CCGGCCAGTGAACCTATGTACTAATCTCGAGATTAGTACATAGGTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022918.2-1314s1c1
Sequence:CCGGGCATCTAAACACTTTCAGGATCTCGAGATCCTGAAAGTGTTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_022918.2-2084s1c1
Sequence:CCGGCCTATGTACTAATGGCAAGTTCTCGAGAACTTGCCATTAGTACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022918.2-140s1c1
Sequence:CCGGGAAGATCTATGCTCCTCTGTACTCGAGTACAGAGGAGCATAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022918.2-1915s1c1
Sequence:CCGGGCTTTCGTGTAGAGCAATTTACTCGAGTAAATTGCTCTACACGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks