EMAIL THIS PAGE TO A FRIEND

TMEM136

transmembrane protein 136

UniProtKB ID: Q6ZRR5, B4DGQ4, B4E230, Q8IZ79
Gene ID:
Mouse(235300) transmembrane protein 136
Rat(315593) transmembrane protein 136
chicken(419753) transmembrane protein 136
domestic cat(101085401) transmembrane protein 136
dog(489360) transmembrane protein 136
domestic guinea pig(100716091) transmembrane protein 136
naked mole-rat(101715638) transmembrane protein 136
cow(520468) transmembrane protein 136
sheep(101116933) transmembrane protein 136
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA074432 Anti-TMEM136 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174926 Rosetta Predictions human pricing
NM_001108136 Rosetta Predictions rat pricing
NM_001034863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065715 predicted 531
2 SASI_Hs01_00065716 predicted 498
3 SASI_Hs02_00368850 predicted 378
4 SASI_Hs01_00065717 predicted 529
5 SASI_Hs01_00065718 predicted 535
6 SASI_Hs01_00065719 predicted 528
7 SASI_Hs01_00065721 predicted 629
8 SASI_Hs01_00065722 predicted 515
9 SASI_Hs02_00368851 predicted 458
10 SASI_Hs01_00065723 predicted 645
11 SASI_Hs01_00065720 predicted 587
12 SASI_Hs01_00065724 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235714 predicted 543
2 SASI_Rn02_00235715 predicted 280
3 SASI_Rn02_00235716 predicted 217
4 SASI_Rn02_00235717 predicted 671
5 SASI_Rn02_00235718 predicted 310
6 SASI_Rn02_00235719 predicted 318
7 SASI_Rn02_00235720 predicted 684
8 SASI_Rn02_00235721 predicted 516
9 SASI_Rn02_00235722 predicted 507
10 SASI_Rn02_00235723 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184565 predicted 888
2 SASI_Mm01_00184566 predicted 801
3 SASI_Mm01_00184567 predicted 815
4 SASI_Mm01_00184568 predicted 572
5 SASI_Mm01_00184569 predicted 1121
6 SASI_Mm01_00184570 predicted 950
7 SASI_Mm01_00184571 predicted 328
8 SASI_Mm01_00184572 predicted 1068
9 SASI_Mm01_00184573 predicted 340
10 SASI_Mm01_00184574 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174926
VALIDATED
TMEM136 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 136
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-622s1c1
Sequence:CCGGCACCTTGGGCTACTTCATCTTCTCGAGAAGATGAAGTAGCCCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-733s1c1
Sequence:CCGGGAAACACAACGGACATCTCAACTCGAGTTGAGATGTCCGTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-664s1c1
Sequence:CCGGCTTTGCATGGAGGAAGAGCATCTCGAGATGCTCTTCCTCCATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-730s1c1
Sequence:CCGGGCTGAAACACAACGGACATCTCTCGAGAGATGTCCGTTGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-769s1c1
Sequence:CCGGGCTTGCTCCAGATTATGGATTCTCGAGAATCCATAATCTGGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174926.1-673s1c1
Sequence:CCGGGAGGAAGAGCATCAAGAAGTACTCGAGTACTTCTTGATGCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174926.1-769s21c1
Sequence:CCGGGCTTGCTCCAGATTATGGATTCTCGAGAATCCATAATCTGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-424s21c1
Sequence:CCGGTGGCTGGCTCTCGCTCTATATCTCGAGATATAGAGCGAGAGCCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-730s21c1
Sequence:CCGGGCTGAAACACAACGGACATCTCTCGAGAGATGTCCGTTGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-372s21c1
Sequence:CCGGTTCATCACAGGATGGCATTAGCTCGAGCTAATGCCATCCTGTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-523s21c1
Sequence:CCGGTATAGGCCTCTCCGCTTATATCTCGAGATATAAGCGGAGAGGCCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174926
VALIDATED
TMEM136 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 136
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-622s1c1
Sequence:CCGGCACCTTGGGCTACTTCATCTTCTCGAGAAGATGAAGTAGCCCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-733s1c1
Sequence:CCGGGAAACACAACGGACATCTCAACTCGAGTTGAGATGTCCGTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-664s1c1
Sequence:CCGGCTTTGCATGGAGGAAGAGCATCTCGAGATGCTCTTCCTCCATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-730s1c1
Sequence:CCGGGCTGAAACACAACGGACATCTCTCGAGAGATGTCCGTTGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-769s1c1
Sequence:CCGGGCTTGCTCCAGATTATGGATTCTCGAGAATCCATAATCTGGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174926.1-673s1c1
Sequence:CCGGGAGGAAGAGCATCAAGAAGTACTCGAGTACTTCTTGATGCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174926.1-769s21c1
Sequence:CCGGGCTTGCTCCAGATTATGGATTCTCGAGAATCCATAATCTGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-424s21c1
Sequence:CCGGTGGCTGGCTCTCGCTCTATATCTCGAGATATAGAGCGAGAGCCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-730s21c1
Sequence:CCGGGCTGAAACACAACGGACATCTCTCGAGAGATGTCCGTTGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-372s21c1
Sequence:CCGGTTCATCACAGGATGGCATTAGCTCGAGCTAATGCCATCCTGTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-523s21c1
Sequence:CCGGTATAGGCCTCTCCGCTTATATCTCGAGATATAAGCGGAGAGGCCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174926
VALIDATED
TMEM136 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 136
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-622s1c1
Sequence:CCGGCACCTTGGGCTACTTCATCTTCTCGAGAAGATGAAGTAGCCCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-733s1c1
Sequence:CCGGGAAACACAACGGACATCTCAACTCGAGTTGAGATGTCCGTTGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-664s1c1
Sequence:CCGGCTTTGCATGGAGGAAGAGCATCTCGAGATGCTCTTCCTCCATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-730s1c1
Sequence:CCGGGCTGAAACACAACGGACATCTCTCGAGAGATGTCCGTTGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_174926.1-769s1c1
Sequence:CCGGGCTTGCTCCAGATTATGGATTCTCGAGAATCCATAATCTGGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174926.1-673s1c1
Sequence:CCGGGAGGAAGAGCATCAAGAAGTACTCGAGTACTTCTTGATGCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174926.1-769s21c1
Sequence:CCGGGCTTGCTCCAGATTATGGATTCTCGAGAATCCATAATCTGGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-424s21c1
Sequence:CCGGTGGCTGGCTCTCGCTCTATATCTCGAGATATAGAGCGAGAGCCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-730s21c1
Sequence:CCGGGCTGAAACACAACGGACATCTCTCGAGAGATGTCCGTTGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-372s21c1
Sequence:CCGGTTCATCACAGGATGGCATTAGCTCGAGCTAATGCCATCCTGTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174926.1-523s21c1
Sequence:CCGGTATAGGCCTCTCCGCTTATATCTCGAGATATAAGCGGAGAGGCCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034863
VALIDATED
TMEM136 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 136
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034863.3-358s21c1
Sequence:CCGGACTTGGGCTGGTGCATCTATTCTCGAGAATAGATGCACCAGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-1539s21c1
Sequence:CCGGTAGTCTCTTGCTTGGATATACCTCGAGGTATATCCAAGCAAGAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-237s21c1
Sequence:CCGGATAGGTCTGTCTGCTTATATTCTCGAGAATATAAGCAGACAGACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-136s21c1
Sequence:CCGGGTGGCTGGCTCTCACTCTATACTCGAGTATAGAGTGAGAGCCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-469s21c1
Sequence:CCGGAGGTCAATGCTGTACTCTTTGCTCGAGCAAAGAGTACAGCATTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034863
VALIDATED
TMEM136 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 136
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034863.3-358s21c1
Sequence:CCGGACTTGGGCTGGTGCATCTATTCTCGAGAATAGATGCACCAGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-1539s21c1
Sequence:CCGGTAGTCTCTTGCTTGGATATACCTCGAGGTATATCCAAGCAAGAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-237s21c1
Sequence:CCGGATAGGTCTGTCTGCTTATATTCTCGAGAATATAAGCAGACAGACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-136s21c1
Sequence:CCGGGTGGCTGGCTCTCACTCTATACTCGAGTATAGAGTGAGAGCCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-469s21c1
Sequence:CCGGAGGTCAATGCTGTACTCTTTGCTCGAGCAAAGAGTACAGCATTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034863
VALIDATED
TMEM136 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 136
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034863.3-358s21c1
Sequence:CCGGACTTGGGCTGGTGCATCTATTCTCGAGAATAGATGCACCAGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-1539s21c1
Sequence:CCGGTAGTCTCTTGCTTGGATATACCTCGAGGTATATCCAAGCAAGAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-237s21c1
Sequence:CCGGATAGGTCTGTCTGCTTATATTCTCGAGAATATAAGCAGACAGACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-136s21c1
Sequence:CCGGGTGGCTGGCTCTCACTCTATACTCGAGTATAGAGTGAGAGCCAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001034863.3-469s21c1
Sequence:CCGGAGGTCAATGCTGTACTCTTTGCTCGAGCAAAGAGTACAGCATTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks