EMAIL THIS PAGE TO A FRIEND

TMEM138

transmembrane protein 138

UniProtKB ID: Q9NPI0, A6NGA7, B4E044, Q5JPE1
Gene ID:
Human(51524) Summary: This gene encodes a multi-pass transmembrane protein. Reduced expression of this gene in mouse fibroblasts causes short cilia and failure of ciliogenesis. Expression of this gene is tightly coordinated with expression of the neighboring gene TMEM216. Mutations in this gene are associated with the autosomal recessive neurodevelopmental disorder Joubert Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Mouse(72982) transmembrane protein 138
Rat(361728) transmembrane protein 138
Zebrafish(100332440) transmembrane protein 138
domestic cat(101081575) transmembrane protein 138
dog(612314) transmembrane protein 138
chicken(426323) transmembrane protein 138
cow(514277) transmembrane protein 138
sheep(101106893) transmembrane protein 138
Goat(100861271) transmembrane protein 138
naked mole-rat(101709534) transmembrane protein 138
domestic guinea pig(100726639) transmembrane protein 138
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102455 Anti-TMEM138 antibody produced in rabbit affinity isolated antibody mouse, bovine, horse, canine, human, rat, rabbit
western blot pricing
HPA042373 Anti-TMEM138 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016464 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016464 Rosetta Predictions human pricing
NM_198777 Rosetta Predictions rat pricing
NM_028411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014675 predicted 664
2 SASI_Hs01_00014676 predicted 549
3 SASI_Hs01_00014677 predicted 557
4 SASI_Hs01_00014678 predicted 461
5 SASI_Hs01_00014679 predicted 225
6 SASI_Hs02_00349511 predicted 550
7 SASI_Hs01_00014681 predicted 616
8 SASI_Hs01_00014682 predicted 501
9 SASI_Hs01_00014683 predicted 278
10 SASI_Hs01_00014684 predicted 634
11 SASI_Hs01_00014680 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270027 predicted 401
2 SASI_Rn02_00270028 predicted 214
3 SASI_Rn02_00270029 predicted 247
4 SASI_Rn02_00270030 predicted 1013
5 SASI_Rn01_00047442 predicted 625
6 SASI_Rn02_00270031 predicted 263
7 SASI_Rn02_00270032 predicted 642
8 SASI_Rn01_00047445 predicted 750
9 SASI_Rn01_00047446 predicted 592
10 SASI_Rn02_00270033 predicted 865
11 SASI_Rn01_00047437 predicted 792
12 SASI_Rn01_00047438 predicted 987
13 SASI_Rn01_00047439 predicted 533
14 SASI_Rn01_00047440 predicted 672
15 SASI_Rn01_00047441 predicted 431
16 SASI_Rn01_00047443 predicted 675
17 SASI_Rn01_00047444 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333803 predicted 291
2 SASI_Mm01_00056847 predicted 208
3 SASI_Mm01_00056848 predicted 241
4 SASI_Mm01_00056849 predicted 487
5 SASI_Mm01_00056851 predicted 452
6 SASI_Mm01_00056852 predicted 594
7 SASI_Mm01_00056854 predicted 642
8 SASI_Mm01_00056855 predicted 255
9 SASI_Mm02_00333804 predicted 650
10 SASI_Mm02_00333805 predicted 219
11 SASI_Mm01_00056850 predicted 544
12 SASI_Mm01_00056853 predicted 548
13 SASI_Mm01_00056856 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016464
TMEM138 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 138
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016464.4-1426s21c1
Sequence:CCGGGATGCGAAGAGTGATAGTTACCTCGAGGTAACTATCACTCTTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016464.4-1463s21c1
Sequence:CCGGACACCGCAGACATTTAGATTTCTCGAGAAATCTAAATGTCTGCGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016464.2-786s1c1
Sequence:CCGGGCTGTGTTCAGCATTCAAGAACTCGAGTTCTTGAATGCTGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016464.2-783s1c1
Sequence:CCGGCTAGCTGTGTTCAGCATTCAACTCGAGTTGAATGCTGAACACAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-516s1c1
Sequence:CCGGGATGGACTTCAAATGCTGTTTCTCGAGAAACAGCATTTGAAGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-530s1c1
Sequence:CCGGGCTGTTTGTATTCCAGAGACTCTCGAGAGTCTCTGGAATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-392s1c1
Sequence:CCGGCCTCCTATTCCATAAGTTCAACTCGAGTTGAACTTATGGAATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-401s1c1
Sequence:CCGGCCATAAGTTCAAAGGGACCATCTCGAGATGGTCCCTTTGAACTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016464
TMEM138 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 138
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016464.4-1426s21c1
Sequence:CCGGGATGCGAAGAGTGATAGTTACCTCGAGGTAACTATCACTCTTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016464.4-1463s21c1
Sequence:CCGGACACCGCAGACATTTAGATTTCTCGAGAAATCTAAATGTCTGCGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016464.2-786s1c1
Sequence:CCGGGCTGTGTTCAGCATTCAAGAACTCGAGTTCTTGAATGCTGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016464.2-783s1c1
Sequence:CCGGCTAGCTGTGTTCAGCATTCAACTCGAGTTGAATGCTGAACACAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-516s1c1
Sequence:CCGGGATGGACTTCAAATGCTGTTTCTCGAGAAACAGCATTTGAAGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-530s1c1
Sequence:CCGGGCTGTTTGTATTCCAGAGACTCTCGAGAGTCTCTGGAATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-392s1c1
Sequence:CCGGCCTCCTATTCCATAAGTTCAACTCGAGTTGAACTTATGGAATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-401s1c1
Sequence:CCGGCCATAAGTTCAAAGGGACCATCTCGAGATGGTCCCTTTGAACTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016464
TMEM138 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 138
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016464.4-1426s21c1
Sequence:CCGGGATGCGAAGAGTGATAGTTACCTCGAGGTAACTATCACTCTTCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016464.4-1463s21c1
Sequence:CCGGACACCGCAGACATTTAGATTTCTCGAGAAATCTAAATGTCTGCGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016464.2-786s1c1
Sequence:CCGGGCTGTGTTCAGCATTCAAGAACTCGAGTTCTTGAATGCTGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016464.2-783s1c1
Sequence:CCGGCTAGCTGTGTTCAGCATTCAACTCGAGTTGAATGCTGAACACAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-516s1c1
Sequence:CCGGGATGGACTTCAAATGCTGTTTCTCGAGAAACAGCATTTGAAGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-530s1c1
Sequence:CCGGGCTGTTTGTATTCCAGAGACTCTCGAGAGTCTCTGGAATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-392s1c1
Sequence:CCGGCCTCCTATTCCATAAGTTCAACTCGAGTTGAACTTATGGAATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016464.2-401s1c1
Sequence:CCGGCCATAAGTTCAAAGGGACCATCTCGAGATGGTCCCTTTGAACTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028411
VALIDATED
TMEM138 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 138
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-388s21c1
Sequence:CCGGAGTTCAAAGGGACCATCATTCCTCGAGGAATGATGGTCCCTTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028411.2-305s21c1
Sequence:CCGGCCTCTTCAACATCATCATAATCTCGAGATTATGATGATGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-248s21c1
Sequence:CCGGACTCCGAATGGCTCCTGTTATCTCGAGATAACAGGAGCCATTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-499s21c1
Sequence:CCGGACGGCCTGCAAACACTGTTTGCTCGAGCAAACAGTGTTTGCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-749s21c1
Sequence:CCGGGGACTTCCTAGGACACATTTACTCGAGTAAATGTGTCCTAGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028411.1-669s1c1
Sequence:CCGGGAATACCTTTCCTTCCTGGTACTCGAGTACCAGGAAGGAAAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028411.1-277s1c1
Sequence:CCGGGTGCTGTTCATCATCCAGGATCTCGAGATCCTGGATGATGAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028411
VALIDATED
TMEM138 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 138
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-388s21c1
Sequence:CCGGAGTTCAAAGGGACCATCATTCCTCGAGGAATGATGGTCCCTTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028411.2-305s21c1
Sequence:CCGGCCTCTTCAACATCATCATAATCTCGAGATTATGATGATGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-248s21c1
Sequence:CCGGACTCCGAATGGCTCCTGTTATCTCGAGATAACAGGAGCCATTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-499s21c1
Sequence:CCGGACGGCCTGCAAACACTGTTTGCTCGAGCAAACAGTGTTTGCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-749s21c1
Sequence:CCGGGGACTTCCTAGGACACATTTACTCGAGTAAATGTGTCCTAGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028411.1-669s1c1
Sequence:CCGGGAATACCTTTCCTTCCTGGTACTCGAGTACCAGGAAGGAAAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028411.1-277s1c1
Sequence:CCGGGTGCTGTTCATCATCCAGGATCTCGAGATCCTGGATGATGAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028411
VALIDATED
TMEM138 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 138
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-388s21c1
Sequence:CCGGAGTTCAAAGGGACCATCATTCCTCGAGGAATGATGGTCCCTTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028411.2-305s21c1
Sequence:CCGGCCTCTTCAACATCATCATAATCTCGAGATTATGATGATGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-248s21c1
Sequence:CCGGACTCCGAATGGCTCCTGTTATCTCGAGATAACAGGAGCCATTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-499s21c1
Sequence:CCGGACGGCCTGCAAACACTGTTTGCTCGAGCAAACAGTGTTTGCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028411.2-749s21c1
Sequence:CCGGGGACTTCCTAGGACACATTTACTCGAGTAAATGTGTCCTAGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028411.1-669s1c1
Sequence:CCGGGAATACCTTTCCTTCCTGGTACTCGAGTACCAGGAAGGAAAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028411.1-277s1c1
Sequence:CCGGGTGCTGTTCATCATCCAGGATCTCGAGATCCTGGATGATGAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks