EMAIL THIS PAGE TO A FRIEND

TMEM139

transmembrane protein 139

UniProtKB ID: Q8IV31, B2RCL5, D3DXD4, Q6ZME2, Q8NC22, Q96AU8
Gene ID:
Mouse(109218) transmembrane protein 139
Rat(680244) transmembrane protein 139
domestic guinea pig(100728075) transmembrane protein 139
naked mole-rat(101710744) transmembrane protein 139
cow(515372) transmembrane protein 139
sheep(101114772) transmembrane protein 139
chicken(101665765) transmembrane protein 139
chicken(101747965) transmembrane protein 139
dog(608825) transmembrane protein 139
domestic cat(101099285) transmembrane protein 139
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153345 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060581 MISSION® esiRNA esiRNA human TMEM139 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153345 Rosetta Predictions human pricing
XM_001056308 Rosetta Predictions rat pricing
NM_175408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018074 predicted 957
2 SASI_Hs01_00018075 predicted 566
3 SASI_Hs01_00018076 predicted 647
4 SASI_Hs01_00018077 predicted 894
5 SASI_Hs01_00018079 predicted 956
6 SASI_Hs01_00018080 predicted 724
7 SASI_Hs01_00018081 predicted 600
8 SASI_Hs02_00367201 predicted 1296
9 SASI_Hs02_00367202 predicted 1281
10 SASI_Hs02_00367203 predicted 1067
11 SASI_Hs01_00018078 predicted 636
12 SASI_Hs01_00018082 predicted 1323
13 SASI_Hs01_00018083 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282870 predicted 683
2 SASI_Rn02_00282871 predicted 609
3 SASI_Rn02_00282872 predicted 765
4 SASI_Rn02_00282873 predicted 676
5 SASI_Rn02_00282874 predicted 402
6 SASI_Rn02_00282875 predicted 269
7 SASI_Rn02_00282876 predicted 566
8 SASI_Rn02_00282877 predicted 760
9 SASI_Rn02_00282878 predicted 795
10 SASI_Rn02_00282879 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045832 predicted 736
2 SASI_Mm01_00045833 predicted 739
3 SASI_Mm01_00045834 predicted 744
4 SASI_Mm01_00045835 predicted 540
5 SASI_Mm01_00045836 predicted 708
6 SASI_Mm01_00045837 predicted 645
7 SASI_Mm01_00045838 predicted 544
8 SASI_Mm01_00045839 predicted 747
9 SASI_Mm01_00045840 predicted 889
10 SASI_Mm02_00346281 predicted 270
11 SASI_Mm01_00045841 predicted 2286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175408
TMEM139 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 139
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.2-1972s1c1
Sequence:CCGGGACAATGACTGCCAGAGGAAACTCGAGTTTCCTCTGGCAGTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.2-2117s1c1
Sequence:CCGGGCTCATGCTGATGATGACAGTCTCGAGACTGTCATCATCAGCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175408.2-2191s1c1
Sequence:CCGGGCACTCATTTGCCCAGCATTTCTCGAGAAATGCTGGGCAAATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.4-416s1c1
Sequence:CCGGCCCTTACAGCAGTATCATAATCTCGAGATTATGATACTGCTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-416s21c1
Sequence:CCGGCCCTTACAGCAGTATCATAATCTCGAGATTATGATACTGCTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-148s21c1
Sequence:CCGGGGCTGGCTTTACTGGTCATACCTCGAGGTATGACCAGTAAAGCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-639s21c1
Sequence:CCGGCCACCTCCTGCCTATGAAATCCTCGAGGATTTCATAGGCAGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175408.4-897s21c1
Sequence:CCGGCCTATCTGATGACCAGTATTTCTCGAGAAATACTGGTCATCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-333s21c1
Sequence:CCGGTTTGAGGTGCCAACCTATGAACTCGAGTTCATAGGTTGGCACCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175408
TMEM139 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 139
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.2-1972s1c1
Sequence:CCGGGACAATGACTGCCAGAGGAAACTCGAGTTTCCTCTGGCAGTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.2-2117s1c1
Sequence:CCGGGCTCATGCTGATGATGACAGTCTCGAGACTGTCATCATCAGCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175408.2-2191s1c1
Sequence:CCGGGCACTCATTTGCCCAGCATTTCTCGAGAAATGCTGGGCAAATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.4-416s1c1
Sequence:CCGGCCCTTACAGCAGTATCATAATCTCGAGATTATGATACTGCTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-416s21c1
Sequence:CCGGCCCTTACAGCAGTATCATAATCTCGAGATTATGATACTGCTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-148s21c1
Sequence:CCGGGGCTGGCTTTACTGGTCATACCTCGAGGTATGACCAGTAAAGCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-639s21c1
Sequence:CCGGCCACCTCCTGCCTATGAAATCCTCGAGGATTTCATAGGCAGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175408.4-897s21c1
Sequence:CCGGCCTATCTGATGACCAGTATTTCTCGAGAAATACTGGTCATCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-333s21c1
Sequence:CCGGTTTGAGGTGCCAACCTATGAACTCGAGTTCATAGGTTGGCACCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175408
TMEM139 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 139
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.2-1972s1c1
Sequence:CCGGGACAATGACTGCCAGAGGAAACTCGAGTTTCCTCTGGCAGTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.2-2117s1c1
Sequence:CCGGGCTCATGCTGATGATGACAGTCTCGAGACTGTCATCATCAGCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175408.2-2191s1c1
Sequence:CCGGGCACTCATTTGCCCAGCATTTCTCGAGAAATGCTGGGCAAATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175408.4-416s1c1
Sequence:CCGGCCCTTACAGCAGTATCATAATCTCGAGATTATGATACTGCTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-416s21c1
Sequence:CCGGCCCTTACAGCAGTATCATAATCTCGAGATTATGATACTGCTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-148s21c1
Sequence:CCGGGGCTGGCTTTACTGGTCATACCTCGAGGTATGACCAGTAAAGCCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-639s21c1
Sequence:CCGGCCACCTCCTGCCTATGAAATCCTCGAGGATTTCATAGGCAGGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175408.4-897s21c1
Sequence:CCGGCCTATCTGATGACCAGTATTTCTCGAGAAATACTGGTCATCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175408.4-333s21c1
Sequence:CCGGTTTGAGGTGCCAACCTATGAACTCGAGTTCATAGGTTGGCACCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153345
TMEM139 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 139
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153345.1-1664s1c1
Sequence:CCGGGCAACTTGCATGTCTCCCAATCTCGAGATTGGGAGACATGCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153345.1-694s1c1
Sequence:CCGGCCAATCAATGCAGACTGAGAGCTCGAGCTCTCAGTCTGCATTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-1070s1c1
Sequence:CCGGCCTGCCTATGATGTCTGCTTTCTCGAGAAAGCAGACATCATAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-603s1c1
Sequence:CCGGCCGTTGCTTATTTCTTTCTCACTCGAGTGAGAAAGAAATAAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-904s1c1
Sequence:CCGGCAAACTGGAACAGAGGCGAATCTCGAGATTCGCCTCTGTTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-749s1c1
Sequence:CCGGGCCTTTGAAGTGCCAGTCTATCTCGAGATAGACTGGCACTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153345.1-1308s21c1
Sequence:CCGGGAGATATGGGTGGCATAATTTCTCGAGAAATTATGCCACCCATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153345.1-831s21c1
Sequence:CCGGCCTACAGCACTGTTGTGATACCTCGAGGTATCACAACAGTGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153345
TMEM139 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 139
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153345.1-1664s1c1
Sequence:CCGGGCAACTTGCATGTCTCCCAATCTCGAGATTGGGAGACATGCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153345.1-694s1c1
Sequence:CCGGCCAATCAATGCAGACTGAGAGCTCGAGCTCTCAGTCTGCATTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-1070s1c1
Sequence:CCGGCCTGCCTATGATGTCTGCTTTCTCGAGAAAGCAGACATCATAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-603s1c1
Sequence:CCGGCCGTTGCTTATTTCTTTCTCACTCGAGTGAGAAAGAAATAAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-904s1c1
Sequence:CCGGCAAACTGGAACAGAGGCGAATCTCGAGATTCGCCTCTGTTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-749s1c1
Sequence:CCGGGCCTTTGAAGTGCCAGTCTATCTCGAGATAGACTGGCACTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153345.1-1308s21c1
Sequence:CCGGGAGATATGGGTGGCATAATTTCTCGAGAAATTATGCCACCCATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153345.1-831s21c1
Sequence:CCGGCCTACAGCACTGTTGTGATACCTCGAGGTATCACAACAGTGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153345
TMEM139 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 139
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153345.1-1664s1c1
Sequence:CCGGGCAACTTGCATGTCTCCCAATCTCGAGATTGGGAGACATGCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153345.1-694s1c1
Sequence:CCGGCCAATCAATGCAGACTGAGAGCTCGAGCTCTCAGTCTGCATTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-1070s1c1
Sequence:CCGGCCTGCCTATGATGTCTGCTTTCTCGAGAAAGCAGACATCATAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-603s1c1
Sequence:CCGGCCGTTGCTTATTTCTTTCTCACTCGAGTGAGAAAGAAATAAGCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-904s1c1
Sequence:CCGGCAAACTGGAACAGAGGCGAATCTCGAGATTCGCCTCTGTTCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153345.1-749s1c1
Sequence:CCGGGCCTTTGAAGTGCCAGTCTATCTCGAGATAGACTGGCACTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153345.1-1308s21c1
Sequence:CCGGGAGATATGGGTGGCATAATTTCTCGAGAAATTATGCCACCCATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153345.1-831s21c1
Sequence:CCGGCCTACAGCACTGTTGTGATACCTCGAGGTATCACAACAGTGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks