EMAIL THIS PAGE TO A FRIEND

TMEM140

transmembrane protein 140

UniProtKB ID: Q9NV12, A4D1P9, Q8WUC3
Gene ID:
Mouse(68487) transmembrane protein 140
Rat(362334) transmembrane protein 140
chicken(417940) transmembrane protein 140
domestic cat(101096303) transmembrane protein 140
dog(608116) transmembrane protein 140-like
cow(515475) transmembrane protein 140
sheep(101121849) transmembrane protein 140
naked mole-rat(101709624) transmembrane protein 140
domestic guinea pig(100722566) transmembrane protein 140
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018295 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018295 Rosetta Predictions human pricing
NM_001009709 Rosetta Predictions rat pricing
NM_197986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107220 predicted 1000
2 SASI_Hs01_00107221 predicted 1271
3 SASI_Hs01_00107222 predicted 1034
4 SASI_Hs01_00107223 predicted 825
5 SASI_Hs01_00107225 predicted 973
6 SASI_Hs02_00351693 predicted 1037
7 SASI_Hs01_00107226 predicted 772
8 SASI_Hs01_00107227 predicted 1014
9 SASI_Hs02_00351694 predicted 1257
10 SASI_Hs02_00351695 predicted 1008
11 SASI_Hs01_00107224 predicted 701
12 SASI_Hs01_00107228 predicted 265
13 SASI_Hs01_00107229 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082155 predicted 610
2 SASI_Rn01_00082156 predicted 362
3 SASI_Rn01_00082157 predicted 290
4 SASI_Rn02_00199770 predicted 568
5 SASI_Rn01_00082158 predicted 539
6 SASI_Rn01_00082159 predicted 601
7 SASI_Rn01_00082160 predicted 224
8 SASI_Rn01_00082161 predicted 598
9 SASI_Rn01_00082162 predicted 424
10 SASI_Rn02_00199771 predicted 528
11 SASI_Rn01_00082163 predicted 552
12 SASI_Rn01_00082164 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198388 predicted 849
2 SASI_Mm01_00198389 predicted 810
3 SASI_Mm01_00198390 predicted 548
4 SASI_Mm02_00350670 predicted 512
5 SASI_Mm01_00198391 predicted 249
6 SASI_Mm01_00198392 predicted 746
7 SASI_Mm01_00198393 predicted 777
8 SASI_Mm01_00198394 predicted 427
9 SASI_Mm01_00198395 predicted 836
10 SASI_Mm01_00198396 predicted 756
11 SASI_Mm01_00198397 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018295
TMEM140 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 140
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018295.3-834s21c1
Sequence:CCGGTGCTAAAGGCTTACGTGATTGCTCGAGCAATCACGTAAGCCTTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018295.3-874s21c1
Sequence:CCGGATGGTCAGAGGTGGCACATCTCTCGAGAGATGTGCCACCTCTGACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018295.3-1116s21c1
Sequence:CCGGATTAATGGATCTGAGCAAATCCTCGAGGATTTGCTCAGATCCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1027s1c1
Sequence:CCGGGCAGCTCATTGTCACACCAATCTCGAGATTGGTGTGACAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018295.1-286s1c1
Sequence:CCGGGATTGTGGTCATCTGCCTGATCTCGAGATCAGGCAGATGACCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1182s1c1
Sequence:CCGGCGGCAACAAACGAGGACATTACTCGAGTAATGTCCTCGTTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018295.1-352s1c1
Sequence:CCGGCAACCTGAGAATCGGCTTCTACTCGAGTAGAAGCCGATTCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018295.1-710s1c1
Sequence:CCGGCTCTTGCTTATAGCCATGGCTCTCGAGAGCCATGGCTATAAGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018295.1-256s1c1
Sequence:CCGGGCTGCTGTTCATGAGCATCATCTCGAGATGATGCTCATGAACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1016s1c1
Sequence:CCGGCCCTAAACCATGCAGCTCATTCTCGAGAATGAGCTGCATGGTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018295
TMEM140 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 140
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018295.3-834s21c1
Sequence:CCGGTGCTAAAGGCTTACGTGATTGCTCGAGCAATCACGTAAGCCTTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018295.3-874s21c1
Sequence:CCGGATGGTCAGAGGTGGCACATCTCTCGAGAGATGTGCCACCTCTGACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018295.3-1116s21c1
Sequence:CCGGATTAATGGATCTGAGCAAATCCTCGAGGATTTGCTCAGATCCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1027s1c1
Sequence:CCGGGCAGCTCATTGTCACACCAATCTCGAGATTGGTGTGACAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018295.1-286s1c1
Sequence:CCGGGATTGTGGTCATCTGCCTGATCTCGAGATCAGGCAGATGACCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1182s1c1
Sequence:CCGGCGGCAACAAACGAGGACATTACTCGAGTAATGTCCTCGTTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018295.1-352s1c1
Sequence:CCGGCAACCTGAGAATCGGCTTCTACTCGAGTAGAAGCCGATTCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018295.1-710s1c1
Sequence:CCGGCTCTTGCTTATAGCCATGGCTCTCGAGAGCCATGGCTATAAGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018295.1-256s1c1
Sequence:CCGGGCTGCTGTTCATGAGCATCATCTCGAGATGATGCTCATGAACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1016s1c1
Sequence:CCGGCCCTAAACCATGCAGCTCATTCTCGAGAATGAGCTGCATGGTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018295
TMEM140 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 140
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018295.3-834s21c1
Sequence:CCGGTGCTAAAGGCTTACGTGATTGCTCGAGCAATCACGTAAGCCTTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018295.3-874s21c1
Sequence:CCGGATGGTCAGAGGTGGCACATCTCTCGAGAGATGTGCCACCTCTGACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018295.3-1116s21c1
Sequence:CCGGATTAATGGATCTGAGCAAATCCTCGAGGATTTGCTCAGATCCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1027s1c1
Sequence:CCGGGCAGCTCATTGTCACACCAATCTCGAGATTGGTGTGACAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018295.1-286s1c1
Sequence:CCGGGATTGTGGTCATCTGCCTGATCTCGAGATCAGGCAGATGACCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1182s1c1
Sequence:CCGGCGGCAACAAACGAGGACATTACTCGAGTAATGTCCTCGTTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018295.1-352s1c1
Sequence:CCGGCAACCTGAGAATCGGCTTCTACTCGAGTAGAAGCCGATTCTCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018295.1-710s1c1
Sequence:CCGGCTCTTGCTTATAGCCATGGCTCTCGAGAGCCATGGCTATAAGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018295.1-256s1c1
Sequence:CCGGGCTGCTGTTCATGAGCATCATCTCGAGATGATGCTCATGAACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018295.1-1016s1c1
Sequence:CCGGCCCTAAACCATGCAGCTCATTCTCGAGAATGAGCTGCATGGTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197986
VALIDATED
TMEM140 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 140
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_197986.2-780s1c1
Sequence:CCGGGGTCTTACAAAGGCTTATTATCTCGAGATAATAAGCCTTTGTAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-393s21c1
Sequence:CCGGATGGGCTCCCTAGCATGTTACCTCGAGGTAACATGCTAGGGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197986.2-2406s21c1
Sequence:CCGGTTTCTCCAAGGCACGAGTTTGCTCGAGCAAACTCGTGCCTTGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-767s21c1
Sequence:CCGGGAACTGTTAGTCCGGTCTTACCTCGAGGTAAGACCGGACTAACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-518s21c1
Sequence:CCGGTCTCCTCCTTGCCCAGTACAACTCGAGTTGTACTGGGCAAGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-737s21c1
Sequence:CCGGACGGGATAAGGAGGACAAGAACTCGAGTTCTTGTCCTCCTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197986.1-756s1c1
Sequence:CCGGGAACCAGTGGGAGAACTGTTACTCGAGTAACAGTTCTCCCACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197986.1-399s1c1
Sequence:CCGGCTCCCTAGCATGTTACAACTTCTCGAGAAGTTGTAACATGCTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197986.1-690s1c1
Sequence:CCGGCCAGCTGTTACTCATCTTCTTCTCGAGAAGAAGATGAGTAACAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197986.1-2096s1c1
Sequence:CCGGGCAGTGAACAATTCATACTAACTCGAGTTAGTATGAATTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197986.1-366s1c1
Sequence:CCGGCTACAACTTCTGTCTGTGGAACTCGAGTTCCACAGACAGAAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197986.1-693s1c1
Sequence:CCGGGCTGTTACTCATCTTCTTGCTCTCGAGAGCAAGAAGATGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197986
VALIDATED
TMEM140 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 140
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_197986.2-780s1c1
Sequence:CCGGGGTCTTACAAAGGCTTATTATCTCGAGATAATAAGCCTTTGTAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-393s21c1
Sequence:CCGGATGGGCTCCCTAGCATGTTACCTCGAGGTAACATGCTAGGGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197986.2-2406s21c1
Sequence:CCGGTTTCTCCAAGGCACGAGTTTGCTCGAGCAAACTCGTGCCTTGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-767s21c1
Sequence:CCGGGAACTGTTAGTCCGGTCTTACCTCGAGGTAAGACCGGACTAACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-518s21c1
Sequence:CCGGTCTCCTCCTTGCCCAGTACAACTCGAGTTGTACTGGGCAAGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-737s21c1
Sequence:CCGGACGGGATAAGGAGGACAAGAACTCGAGTTCTTGTCCTCCTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197986.1-756s1c1
Sequence:CCGGGAACCAGTGGGAGAACTGTTACTCGAGTAACAGTTCTCCCACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197986.1-399s1c1
Sequence:CCGGCTCCCTAGCATGTTACAACTTCTCGAGAAGTTGTAACATGCTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197986.1-690s1c1
Sequence:CCGGCCAGCTGTTACTCATCTTCTTCTCGAGAAGAAGATGAGTAACAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197986.1-2096s1c1
Sequence:CCGGGCAGTGAACAATTCATACTAACTCGAGTTAGTATGAATTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197986.1-366s1c1
Sequence:CCGGCTACAACTTCTGTCTGTGGAACTCGAGTTCCACAGACAGAAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197986.1-693s1c1
Sequence:CCGGGCTGTTACTCATCTTCTTGCTCTCGAGAGCAAGAAGATGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197986
VALIDATED
TMEM140 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 140
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_197986.2-780s1c1
Sequence:CCGGGGTCTTACAAAGGCTTATTATCTCGAGATAATAAGCCTTTGTAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-393s21c1
Sequence:CCGGATGGGCTCCCTAGCATGTTACCTCGAGGTAACATGCTAGGGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197986.2-2406s21c1
Sequence:CCGGTTTCTCCAAGGCACGAGTTTGCTCGAGCAAACTCGTGCCTTGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-767s21c1
Sequence:CCGGGAACTGTTAGTCCGGTCTTACCTCGAGGTAAGACCGGACTAACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-518s21c1
Sequence:CCGGTCTCCTCCTTGCCCAGTACAACTCGAGTTGTACTGGGCAAGGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197986.2-737s21c1
Sequence:CCGGACGGGATAAGGAGGACAAGAACTCGAGTTCTTGTCCTCCTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197986.1-756s1c1
Sequence:CCGGGAACCAGTGGGAGAACTGTTACTCGAGTAACAGTTCTCCCACTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197986.1-399s1c1
Sequence:CCGGCTCCCTAGCATGTTACAACTTCTCGAGAAGTTGTAACATGCTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197986.1-690s1c1
Sequence:CCGGCCAGCTGTTACTCATCTTCTTCTCGAGAAGAAGATGAGTAACAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197986.1-2096s1c1
Sequence:CCGGGCAGTGAACAATTCATACTAACTCGAGTTAGTATGAATTGTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197986.1-366s1c1
Sequence:CCGGCTACAACTTCTGTCTGTGGAACTCGAGTTCCACAGACAGAAGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197986.1-693s1c1
Sequence:CCGGGCTGTTACTCATCTTCTTGCTCTCGAGAGCAAGAAGATGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks