EMAIL THIS PAGE TO A FRIEND

TMEM141

transmembrane protein 141

Synonyms: RP11-216L13.7
UniProtKB ID: Q96I45, A6NIZ7, Q5T5R5
Gene ID:
Mouse(51875) transmembrane protein 141
Rat(499755) transmembrane protein 141
naked mole-rat(101713102) transmembrane protein 141
cow(514305) transmembrane protein 141
sheep(101108998) transmembrane protein 141
Zebrafish(767658) transmembrane protein 141
dog(607204) transmembrane protein 141
domestic cat(101095385) transmembrane protein 141
chicken(417294) transmembrane protein 141
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001040130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032928 Rosetta Predictions human pricing
NM_001109197 Rosetta Predictions rat pricing
NM_001040130 Rosetta Predictions mouse pricing
NM_001109993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360539 predicted 586
2 SASI_Hs01_00222802 predicted 411
3 SASI_Hs01_00222803 predicted 474
4 SASI_Hs01_00222804 predicted 280
5 SASI_Hs01_00222805 predicted 302
6 SASI_Hs01_00222806 predicted 346
7 SASI_Hs01_00222807 predicted 288
8 SASI_Hs02_00360540 predicted 601
9 SASI_Hs02_00360541 predicted 200
10 SASI_Hs02_00360542 predicted 590
11 SASI_Hs01_00222801 predicted 205
12 SASI_Hs01_00222808 predicted 380
13 SASI_Hs01_00222809 predicted 482
14 SASI_Hs01_00222810 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246050 predicted 432
2 SASI_Rn02_00246051 predicted 325
3 SASI_Rn02_00246052 predicted 242
4 SASI_Rn02_00246053 predicted 447
5 SASI_Rn02_00246054 predicted 324
6 SASI_Rn02_00246055 predicted 315
7 SASI_Rn02_00246056 predicted 228
8 SASI_Rn02_00246057 predicted 269
9 SASI_Rn02_00246058 predicted 256
10 SASI_Rn02_00246059 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119915 predicted 147
2 SASI_Mm02_00290278 predicted 237
3 SASI_Mm02_00290279 predicted 100
4 SASI_Mm02_00290280 predicted 216
5 SASI_Mm02_00290281 predicted 715
6 SASI_Mm01_00119917 predicted 191
7 SASI_Mm02_00290282 predicted 322
8 SASI_Mm02_00290283 predicted 374
9 SASI_Mm02_00290284 predicted 241
10 SASI_Mm02_00290285 predicted 749
11 SASI_Mm01_00119913 predicted 324
12 SASI_Mm01_00119914 predicted 352
13 SASI_Mm01_00119916 predicted 350
14 SASI_Mm01_00119918 predicted 409
15 SASI_Mm01_00119919 predicted 405
16 SASI_Mm01_00119920 predicted 403
17 SASI_Mm01_00119921 predicted 393
18 SASI_Mm01_00119922 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304554 predicted 412
2 SASI_Mm02_00304555 predicted 491
3 SASI_Mm02_00304556 predicted 480
4 SASI_Mm02_00304557 predicted 978
5 SASI_Mm02_00304558 predicted 454
6 SASI_Mm02_00304559 predicted 576
7 SASI_Mm02_00304560 predicted 638
8 SASI_Mm02_00304561 predicted 503
9 SASI_Mm02_00304562 predicted 1010
10 SASI_Mm02_00304563 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032928
VALIDATED
TMEM141 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 141
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-173s1c1
Sequence:CCGGCAGAGGAAGTTTCCATACCCTCTCGAGAGGGTATGGAAACTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-175s1c1
Sequence:CCGGGAGGAAGTTTCCATACCCTTTCTCGAGAAAGGGTATGGAAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032928.2-169s1c1
Sequence:CCGGCATTCAGAGGAAGTTTCCATACTCGAGTATGGAAACTTCCTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-163s1c1
Sequence:CCGGGATGTTCATTCAGAGGAAGTTCTCGAGAACTTCCTCTGAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-160s1c1
Sequence:CCGGGCAGATGTTCATTCAGAGGAACTCGAGTTCCTCTGAATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-565s1c1
Sequence:CCGGGTGTTTCTCCTCTAGGGTATTCTCGAGAATACCCTAGAGGAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-268s1c1
Sequence:CCGGGAAATGCAACAACCTCTGGCTCTCGAGAGCCAGAGGTTGTTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032928.2-264s1c1
Sequence:CCGGCGGAGAAATGCAACAACCTCTCTCGAGAGAGGTTGTTGCATTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-313s1c1
Sequence:CCGGCAAAGACAGGAGCACAGATCACTCGAGTGATCTGTGCTCCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-260s1c1
Sequence:CCGGGAGTCGGAGAAATGCAACAACCTCGAGGTTGTTGCATTTCTCCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-262s1c1
Sequence:CCGGGTCGGAGAAATGCAACAACCTCTCGAGAGGTTGTTGCATTTCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-322s1c1
Sequence:CCGGGAGCACAGATCAGAGAAGCTACTCGAGTAGCTTCTCTGATCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-205s21c1
Sequence:CCGGGAGGAAGTTTCCATACCCTTTCTCGAGAAAGGGTATGGAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-193s21c1
Sequence:CCGGGATGTTCATTCAGAGGAAGTTCTCGAGAACTTCCTCTGAATGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-595s21c1
Sequence:CCGGGTGTTTCTCCTCTAGGGTATTCTCGAGAATACCCTAGAGGAGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032928.3-343s21c1
Sequence:CCGGCAAAGACAGGAGCACAGATCACTCGAGTGATCTGTGCTCCTGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032928
VALIDATED
TMEM141 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 141
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-173s1c1
Sequence:CCGGCAGAGGAAGTTTCCATACCCTCTCGAGAGGGTATGGAAACTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-175s1c1
Sequence:CCGGGAGGAAGTTTCCATACCCTTTCTCGAGAAAGGGTATGGAAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032928.2-169s1c1
Sequence:CCGGCATTCAGAGGAAGTTTCCATACTCGAGTATGGAAACTTCCTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-163s1c1
Sequence:CCGGGATGTTCATTCAGAGGAAGTTCTCGAGAACTTCCTCTGAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-160s1c1
Sequence:CCGGGCAGATGTTCATTCAGAGGAACTCGAGTTCCTCTGAATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-565s1c1
Sequence:CCGGGTGTTTCTCCTCTAGGGTATTCTCGAGAATACCCTAGAGGAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-268s1c1
Sequence:CCGGGAAATGCAACAACCTCTGGCTCTCGAGAGCCAGAGGTTGTTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032928.2-264s1c1
Sequence:CCGGCGGAGAAATGCAACAACCTCTCTCGAGAGAGGTTGTTGCATTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-313s1c1
Sequence:CCGGCAAAGACAGGAGCACAGATCACTCGAGTGATCTGTGCTCCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-260s1c1
Sequence:CCGGGAGTCGGAGAAATGCAACAACCTCGAGGTTGTTGCATTTCTCCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-262s1c1
Sequence:CCGGGTCGGAGAAATGCAACAACCTCTCGAGAGGTTGTTGCATTTCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-322s1c1
Sequence:CCGGGAGCACAGATCAGAGAAGCTACTCGAGTAGCTTCTCTGATCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-205s21c1
Sequence:CCGGGAGGAAGTTTCCATACCCTTTCTCGAGAAAGGGTATGGAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-193s21c1
Sequence:CCGGGATGTTCATTCAGAGGAAGTTCTCGAGAACTTCCTCTGAATGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-595s21c1
Sequence:CCGGGTGTTTCTCCTCTAGGGTATTCTCGAGAATACCCTAGAGGAGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032928.3-343s21c1
Sequence:CCGGCAAAGACAGGAGCACAGATCACTCGAGTGATCTGTGCTCCTGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032928
VALIDATED
TMEM141 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 141
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-173s1c1
Sequence:CCGGCAGAGGAAGTTTCCATACCCTCTCGAGAGGGTATGGAAACTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-175s1c1
Sequence:CCGGGAGGAAGTTTCCATACCCTTTCTCGAGAAAGGGTATGGAAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032928.2-169s1c1
Sequence:CCGGCATTCAGAGGAAGTTTCCATACTCGAGTATGGAAACTTCCTCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-163s1c1
Sequence:CCGGGATGTTCATTCAGAGGAAGTTCTCGAGAACTTCCTCTGAATGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-160s1c1
Sequence:CCGGGCAGATGTTCATTCAGAGGAACTCGAGTTCCTCTGAATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-565s1c1
Sequence:CCGGGTGTTTCTCCTCTAGGGTATTCTCGAGAATACCCTAGAGGAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-268s1c1
Sequence:CCGGGAAATGCAACAACCTCTGGCTCTCGAGAGCCAGAGGTTGTTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032928.2-264s1c1
Sequence:CCGGCGGAGAAATGCAACAACCTCTCTCGAGAGAGGTTGTTGCATTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-313s1c1
Sequence:CCGGCAAAGACAGGAGCACAGATCACTCGAGTGATCTGTGCTCCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-260s1c1
Sequence:CCGGGAGTCGGAGAAATGCAACAACCTCGAGGTTGTTGCATTTCTCCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-262s1c1
Sequence:CCGGGTCGGAGAAATGCAACAACCTCTCGAGAGGTTGTTGCATTTCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032928.2-322s1c1
Sequence:CCGGGAGCACAGATCAGAGAAGCTACTCGAGTAGCTTCTCTGATCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-205s21c1
Sequence:CCGGGAGGAAGTTTCCATACCCTTTCTCGAGAAAGGGTATGGAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-193s21c1
Sequence:CCGGGATGTTCATTCAGAGGAAGTTCTCGAGAACTTCCTCTGAATGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_032928.3-595s21c1
Sequence:CCGGGTGTTTCTCCTCTAGGGTATTCTCGAGAATACCCTAGAGGAGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032928.3-343s21c1
Sequence:CCGGCAAAGACAGGAGCACAGATCACTCGAGTGATCTGTGCTCCTGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040130
VALIDATED
TMEM141 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 141
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040130.3-196s21c1
Sequence:CCGGCAGTGGAGCTTCCTAGTGTCTCTCGAGAGACACTAGGAAGCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-251s21c1
Sequence:CCGGCAAGTATGGAGTGTCAGAAATCTCGAGATTTCTGACACTCCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040130.3-395s21c1
Sequence:CCGGACAGATCTAACGTCATCTAACCTCGAGGTTAGATGACGTTAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-325s21c1
Sequence:CCGGACAGATCCTCACGACTAGAAGCTCGAGCTTCTAGTCGTGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-152s21c1
Sequence:CCGGTTGGCCTGCTGATGTTCATTACTCGAGTAATGAACATCAGCAGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040130
VALIDATED
TMEM141 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 141
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040130.3-196s21c1
Sequence:CCGGCAGTGGAGCTTCCTAGTGTCTCTCGAGAGACACTAGGAAGCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-251s21c1
Sequence:CCGGCAAGTATGGAGTGTCAGAAATCTCGAGATTTCTGACACTCCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040130.3-395s21c1
Sequence:CCGGACAGATCTAACGTCATCTAACCTCGAGGTTAGATGACGTTAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-325s21c1
Sequence:CCGGACAGATCCTCACGACTAGAAGCTCGAGCTTCTAGTCGTGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-152s21c1
Sequence:CCGGTTGGCCTGCTGATGTTCATTACTCGAGTAATGAACATCAGCAGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040130
VALIDATED
TMEM141 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 141
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040130.3-196s21c1
Sequence:CCGGCAGTGGAGCTTCCTAGTGTCTCTCGAGAGACACTAGGAAGCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-251s21c1
Sequence:CCGGCAAGTATGGAGTGTCAGAAATCTCGAGATTTCTGACACTCCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001040130.3-395s21c1
Sequence:CCGGACAGATCTAACGTCATCTAACCTCGAGGTTAGATGACGTTAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-325s21c1
Sequence:CCGGACAGATCCTCACGACTAGAAGCTCGAGCTTCTAGTCGTGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040130.3-152s21c1
Sequence:CCGGTTGGCCTGCTGATGTTCATTACTCGAGTAATGAACATCAGCAGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks