EMAIL THIS PAGE TO A FRIEND

TMEM143

transmembrane protein 143

UniProtKB ID: Q96AN5, A8K656, Q6UXY4, Q9NV49
Gene ID:
Mouse(70209) transmembrane protein 143
Rat(308593) transmembrane protein 143
domestic cat(101094806) transmembrane protein 143
Horse(100053673) transmembrane protein 143
dog(612068) transmembrane protein 143
cow(505862) transmembrane protein 143
sheep(101121540) transmembrane protein 143
naked mole-rat(101696852) transmembrane protein 143
domestic guinea pig(100731993) transmembrane protein 143
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018273 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011321 MISSION® esiRNA esiRNA targeting human TMEM143 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018273 Rosetta Predictions human pricing
NM_001107513 Rosetta Predictions rat pricing
NM_144801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184493 predicted 1387
2 SASI_Hs01_00184494 predicted 411
3 SASI_Hs01_00184495 predicted 1603
4 SASI_Hs01_00184496 predicted 1799
5 SASI_Hs02_00351646 predicted 1032
6 SASI_Hs01_00184497 predicted 551
7 SASI_Hs02_00351647 predicted 1443
8 SASI_Hs01_00184498 predicted 1550
9 SASI_Hs01_00184499 predicted 1512
10 SASI_Hs01_00184500 predicted 1650
11 SASI_Hs01_00184492 predicted 1459
12 SASI_Hs01_00184501 predicted 1857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229565 predicted 657
2 SASI_Rn02_00229566 predicted 1110
3 SASI_Rn02_00229567 predicted 1301
4 SASI_Rn02_00229568 predicted 1312
5 SASI_Rn02_00229569 predicted 633
6 SASI_Rn02_00229570 predicted 377
7 SASI_Rn02_00229571 predicted 615
8 SASI_Rn02_00229572 predicted 473
9 SASI_Rn02_00229573 predicted 866
10 SASI_Rn02_00229574 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047744 predicted 567
2 SASI_Mm01_00047745 predicted 484
3 SASI_Mm01_00047746 predicted 532
4 SASI_Mm01_00047748 predicted 1481
5 SASI_Mm01_00047749 predicted 960
6 SASI_Mm02_00340149 predicted 1280
7 SASI_Mm01_00047751 predicted 1203
8 SASI_Mm01_00047752 predicted 577
9 SASI_Mm01_00047753 predicted 316
10 SASI_Mm02_00340150 predicted 1316
11 SASI_Mm01_00047747 predicted 1209
12 SASI_Mm01_00047750 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144801
VALIDATED
TMEM143 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 143
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-1213s21c1
Sequence:CCGGCCAATCAGGCTGTGATGTAACCTCGAGGTTACATCACAGCCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144801.2-321s21c1
Sequence:CCGGTGGACTTCTGTACCCTCTTTCCTCGAGGAAAGAGGGTACAGAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-882s21c1
Sequence:CCGGTCAACGTGGGCATGGTGATACCTCGAGGTATCACCATGCCCACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144801.2-1595s21c1
Sequence:CCGGACCAATCAAAGCCGTTTATTTCTCGAGAAATAAACGGCTTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-556s21c1
Sequence:CCGGTGAGGTCCAGGTGACAATAAACTCGAGTTTATTGTCACCTGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144801.1-1599s1c1
Sequence:CCGGGCCGTTTATTTCAACTTGTTACTCGAGTAACAAGTTGAAATAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144801.1-518s1c1
Sequence:CCGGGCTTATGCACTAGTCGTCCATCTCGAGATGGACGACTAGTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144801
VALIDATED
TMEM143 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 143
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-1213s21c1
Sequence:CCGGCCAATCAGGCTGTGATGTAACCTCGAGGTTACATCACAGCCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144801.2-321s21c1
Sequence:CCGGTGGACTTCTGTACCCTCTTTCCTCGAGGAAAGAGGGTACAGAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-882s21c1
Sequence:CCGGTCAACGTGGGCATGGTGATACCTCGAGGTATCACCATGCCCACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144801.2-1595s21c1
Sequence:CCGGACCAATCAAAGCCGTTTATTTCTCGAGAAATAAACGGCTTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-556s21c1
Sequence:CCGGTGAGGTCCAGGTGACAATAAACTCGAGTTTATTGTCACCTGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144801.1-1599s1c1
Sequence:CCGGGCCGTTTATTTCAACTTGTTACTCGAGTAACAAGTTGAAATAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144801.1-518s1c1
Sequence:CCGGGCTTATGCACTAGTCGTCCATCTCGAGATGGACGACTAGTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144801
VALIDATED
TMEM143 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 143
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-1213s21c1
Sequence:CCGGCCAATCAGGCTGTGATGTAACCTCGAGGTTACATCACAGCCTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144801.2-321s21c1
Sequence:CCGGTGGACTTCTGTACCCTCTTTCCTCGAGGAAAGAGGGTACAGAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-882s21c1
Sequence:CCGGTCAACGTGGGCATGGTGATACCTCGAGGTATCACCATGCCCACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144801.2-1595s21c1
Sequence:CCGGACCAATCAAAGCCGTTTATTTCTCGAGAAATAAACGGCTTTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144801.2-556s21c1
Sequence:CCGGTGAGGTCCAGGTGACAATAAACTCGAGTTTATTGTCACCTGGACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144801.1-1599s1c1
Sequence:CCGGGCCGTTTATTTCAACTTGTTACTCGAGTAACAAGTTGAAATAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144801.1-518s1c1
Sequence:CCGGGCTTATGCACTAGTCGTCCATCTCGAGATGGACGACTAGTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018273
VALIDATED
TMEM143 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 143
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-578s21c1
Sequence:CCGGCAGTAAATTTGGATCAGTATGCTCGAGCATACTGATCCAAATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-1022s21c1
Sequence:CCGGTGGCGCACATGCTGTACTATCCTCGAGGATAGTACAGCATGTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-1637s21c1
Sequence:CCGGAGTCCCACCCTCACCATAAATCTCGAGATTTATGGTGAGGGTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-695s21c1
Sequence:CCGGCTGCGGAGAGGAGATACTTTACTCGAGTAAAGTATCTCCTCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-414s21c1
Sequence:CCGGCCTCGATCAGCCATCACTAACCTCGAGGTTAGTGATGGCTGATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-1038s1c1
Sequence:CCGGCTATCGCAGTACGTCCAACAACTCGAGTTGTTGGACGTACTGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-565s1c1
Sequence:CCGGGAGGTCCAGGTGACAGTAAATCTCGAGATTTACTGTCACCTGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-753s1c1
Sequence:CCGGCCTGGTACTGAAGAGTTTCAACTCGAGTTGAAACTCTTCAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-754s1c1
Sequence:CCGGCTGGTACTGAAGAGTTTCAAGCTCGAGCTTGAAACTCTTCAGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-343s1c1
Sequence:CCGGCTGTTCCACTACCACCAAATCCTCGAGGATTTGGTGGTAGTGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-749s1c1
Sequence:CCGGGACACCTGGTACTGAAGAGTTCTCGAGAACTCTTCAGTACCAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-228s1c1
Sequence:CCGGCTTCATTCCCTTCTCCAAGGACTCGAGTCCTTGGAGAAGGGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-2033s1c1
Sequence:CCGGGCTAGGTAGGTGAACCAGAAACTCGAGTTTCTGGTTCACCTACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-702s1c1
Sequence:CCGGGAGGAGATACTTTAAGCGGGTCTCGAGACCCGCTTAAAGTATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-1730s1c1
Sequence:CCGGCCGCCAGGTAGAAGAGTTAAACTCGAGTTTAACTCTTCTACCTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018273
VALIDATED
TMEM143 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 143
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-578s21c1
Sequence:CCGGCAGTAAATTTGGATCAGTATGCTCGAGCATACTGATCCAAATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-1022s21c1
Sequence:CCGGTGGCGCACATGCTGTACTATCCTCGAGGATAGTACAGCATGTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-1637s21c1
Sequence:CCGGAGTCCCACCCTCACCATAAATCTCGAGATTTATGGTGAGGGTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-695s21c1
Sequence:CCGGCTGCGGAGAGGAGATACTTTACTCGAGTAAAGTATCTCCTCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-414s21c1
Sequence:CCGGCCTCGATCAGCCATCACTAACCTCGAGGTTAGTGATGGCTGATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-1038s1c1
Sequence:CCGGCTATCGCAGTACGTCCAACAACTCGAGTTGTTGGACGTACTGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-565s1c1
Sequence:CCGGGAGGTCCAGGTGACAGTAAATCTCGAGATTTACTGTCACCTGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-753s1c1
Sequence:CCGGCCTGGTACTGAAGAGTTTCAACTCGAGTTGAAACTCTTCAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-754s1c1
Sequence:CCGGCTGGTACTGAAGAGTTTCAAGCTCGAGCTTGAAACTCTTCAGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-343s1c1
Sequence:CCGGCTGTTCCACTACCACCAAATCCTCGAGGATTTGGTGGTAGTGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-749s1c1
Sequence:CCGGGACACCTGGTACTGAAGAGTTCTCGAGAACTCTTCAGTACCAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-228s1c1
Sequence:CCGGCTTCATTCCCTTCTCCAAGGACTCGAGTCCTTGGAGAAGGGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-2033s1c1
Sequence:CCGGGCTAGGTAGGTGAACCAGAAACTCGAGTTTCTGGTTCACCTACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-702s1c1
Sequence:CCGGGAGGAGATACTTTAAGCGGGTCTCGAGACCCGCTTAAAGTATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-1730s1c1
Sequence:CCGGCCGCCAGGTAGAAGAGTTAAACTCGAGTTTAACTCTTCTACCTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018273
VALIDATED
TMEM143 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 143
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-578s21c1
Sequence:CCGGCAGTAAATTTGGATCAGTATGCTCGAGCATACTGATCCAAATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-1022s21c1
Sequence:CCGGTGGCGCACATGCTGTACTATCCTCGAGGATAGTACAGCATGTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-1637s21c1
Sequence:CCGGAGTCCCACCCTCACCATAAATCTCGAGATTTATGGTGAGGGTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-695s21c1
Sequence:CCGGCTGCGGAGAGGAGATACTTTACTCGAGTAAAGTATCTCCTCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018273.2-414s21c1
Sequence:CCGGCCTCGATCAGCCATCACTAACCTCGAGGTTAGTGATGGCTGATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-1038s1c1
Sequence:CCGGCTATCGCAGTACGTCCAACAACTCGAGTTGTTGGACGTACTGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-565s1c1
Sequence:CCGGGAGGTCCAGGTGACAGTAAATCTCGAGATTTACTGTCACCTGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-753s1c1
Sequence:CCGGCCTGGTACTGAAGAGTTTCAACTCGAGTTGAAACTCTTCAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-754s1c1
Sequence:CCGGCTGGTACTGAAGAGTTTCAAGCTCGAGCTTGAAACTCTTCAGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-343s1c1
Sequence:CCGGCTGTTCCACTACCACCAAATCCTCGAGGATTTGGTGGTAGTGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-749s1c1
Sequence:CCGGGACACCTGGTACTGAAGAGTTCTCGAGAACTCTTCAGTACCAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-228s1c1
Sequence:CCGGCTTCATTCCCTTCTCCAAGGACTCGAGTCCTTGGAGAAGGGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-2033s1c1
Sequence:CCGGGCTAGGTAGGTGAACCAGAAACTCGAGTTTCTGGTTCACCTACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018273.2-702s1c1
Sequence:CCGGGAGGAGATACTTTAAGCGGGTCTCGAGACCCGCTTAAAGTATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018273.2-1730s1c1
Sequence:CCGGCCGCCAGGTAGAAGAGTTAAACTCGAGTTTAACTCTTCTACCTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks