EMAIL THIS PAGE TO A FRIEND

TMEM144

transmembrane protein 144

UniProtKB ID: Q7Z5S9, D3DP24, Q49A05, Q9NUT3
Gene ID:
Mouse(70652) transmembrane protein 144
Rat(361968) transmembrane protein 144
domestic guinea pig(100726692) transmembrane protein 144
cow(514175) transmembrane protein 144
sheep(101107634) transmembrane protein 144
chicken(422414) transmembrane protein 144
domestic cat(101087735) transmembrane protein 144
Horse(100061910) transmembrane protein 144
dog(482668) transmembrane protein 144
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018342 Rosetta Predictions human pricing
NM_001108551 Rosetta Predictions rat pricing
NM_027495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143220 predicted 1043
2 SASI_Hs01_00143221 predicted 474
3 SASI_Hs01_00143222 predicted 405
4 SASI_Hs01_00143223 predicted 770
5 SASI_Hs01_00143224 predicted 407
6 SASI_Hs01_00143225 predicted 843
7 SASI_Hs01_00143226 predicted 820
8 SASI_Hs01_00143227 predicted 629
9 SASI_Hs01_00143228 predicted 833
10 SASI_Hs01_00143229 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239759 predicted 1149
2 SASI_Rn02_00239760 predicted 955
3 SASI_Rn02_00239761 predicted 961
4 SASI_Rn02_00239762 predicted 1032
5 SASI_Rn02_00239763 predicted 744
6 SASI_Rn02_00239764 predicted 948
7 SASI_Rn02_00239765 predicted 930
8 SASI_Rn02_00239766 predicted 575
9 SASI_Rn02_00239767 predicted 405
10 SASI_Rn02_00239768 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087890 predicted 1135
2 SASI_Mm01_00087891 predicted 402
3 SASI_Mm02_00332322 predicted 1067
4 SASI_Mm01_00087892 predicted 1287
5 SASI_Mm01_00087893 predicted 1248
6 SASI_Mm01_00087894 predicted 1211
7 SASI_Mm01_00087895 predicted 824
8 SASI_Mm01_00087896 predicted 391
9 SASI_Mm01_00087897 predicted 932
10 SASI_Mm01_00087898 predicted 923
11 SASI_Mm01_00087899 predicted 1322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027495
VALIDATED
TMEM144 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 144
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027495.2-599s1c1
Sequence:CCGGCCATCGGTTTAGGACTTGGAACTCGAGTTCCAAGTCCTAAACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027495.2-1647s1c1
Sequence:CCGGCGGATCATCCTGTCTAACAATCTCGAGATTGTTAGACAGGATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027495.2-1327s1c1
Sequence:CCGGCTCGCTTTCTGCATCATCTTACTCGAGTAAGATGATGCAGAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-917s1c1
Sequence:CCGGGCCTTGCGGTAATATCTGGAACTCGAGTTCCAGATATTACCGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-600s1c1
Sequence:CCGGCATCGGTTTAGGACTTGGAATCTCGAGATTCCAAGTCCTAAACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-918s1c1
Sequence:CCGGCCTTGCGGTAATATCTGGAATCTCGAGATTCCAGATATTACCGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027495.2-404s1c1
Sequence:CCGGGCTCCAACTTTGTACCACTTACTCGAGTAAGTGGTACAAAGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-1193s21c1
Sequence:CCGGCATCGCCAACCACTCACTAAGCTCGAGCTTAGTGAGTGGTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027495.4-1501s21c1
Sequence:CCGGTCTGGGAATGAACGGATAAATCTCGAGATTTATCCGTTCATTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-936s21c1
Sequence:CCGGATACTCTACGGATCGACATTTCTCGAGAAATGTCGATCCGTAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027495.4-1715s1c1
Sequence:CCGGGAAATTACCATCCCAATTTATCTCGAGATAAATTGGGATGGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-629s21c1
Sequence:CCGGGGGATCATTTAACACCTTAACCTCGAGGTTAAGGTGTTAAATGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-506s21c1
Sequence:CCGGGATACTGCACTGCCCTAAATTCTCGAGAATTTAGGGCAGTGCAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-1010s21c1
Sequence:CCGGAGGCGCTAGCCAGTATGATTTCTCGAGAAATCATACTGGCTAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027495.4-1647s21c1
Sequence:CCGGGGATCATCCTGTCTAACAATGCTCGAGCATTGTTAGACAGGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-556s21c1
Sequence:CCGGTTTGGGCAACAGGCAACATTGCTCGAGCAATGTTGCCTGTTGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027495
VALIDATED
TMEM144 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 144
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027495.2-599s1c1
Sequence:CCGGCCATCGGTTTAGGACTTGGAACTCGAGTTCCAAGTCCTAAACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027495.2-1647s1c1
Sequence:CCGGCGGATCATCCTGTCTAACAATCTCGAGATTGTTAGACAGGATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027495.2-1327s1c1
Sequence:CCGGCTCGCTTTCTGCATCATCTTACTCGAGTAAGATGATGCAGAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-917s1c1
Sequence:CCGGGCCTTGCGGTAATATCTGGAACTCGAGTTCCAGATATTACCGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-600s1c1
Sequence:CCGGCATCGGTTTAGGACTTGGAATCTCGAGATTCCAAGTCCTAAACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-918s1c1
Sequence:CCGGCCTTGCGGTAATATCTGGAATCTCGAGATTCCAGATATTACCGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027495.2-404s1c1
Sequence:CCGGGCTCCAACTTTGTACCACTTACTCGAGTAAGTGGTACAAAGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-1193s21c1
Sequence:CCGGCATCGCCAACCACTCACTAAGCTCGAGCTTAGTGAGTGGTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027495.4-1501s21c1
Sequence:CCGGTCTGGGAATGAACGGATAAATCTCGAGATTTATCCGTTCATTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-936s21c1
Sequence:CCGGATACTCTACGGATCGACATTTCTCGAGAAATGTCGATCCGTAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027495.4-1715s1c1
Sequence:CCGGGAAATTACCATCCCAATTTATCTCGAGATAAATTGGGATGGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-629s21c1
Sequence:CCGGGGGATCATTTAACACCTTAACCTCGAGGTTAAGGTGTTAAATGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-506s21c1
Sequence:CCGGGATACTGCACTGCCCTAAATTCTCGAGAATTTAGGGCAGTGCAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-1010s21c1
Sequence:CCGGAGGCGCTAGCCAGTATGATTTCTCGAGAAATCATACTGGCTAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027495.4-1647s21c1
Sequence:CCGGGGATCATCCTGTCTAACAATGCTCGAGCATTGTTAGACAGGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-556s21c1
Sequence:CCGGTTTGGGCAACAGGCAACATTGCTCGAGCAATGTTGCCTGTTGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027495
VALIDATED
TMEM144 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 144
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027495.2-599s1c1
Sequence:CCGGCCATCGGTTTAGGACTTGGAACTCGAGTTCCAAGTCCTAAACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027495.2-1647s1c1
Sequence:CCGGCGGATCATCCTGTCTAACAATCTCGAGATTGTTAGACAGGATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027495.2-1327s1c1
Sequence:CCGGCTCGCTTTCTGCATCATCTTACTCGAGTAAGATGATGCAGAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-917s1c1
Sequence:CCGGGCCTTGCGGTAATATCTGGAACTCGAGTTCCAGATATTACCGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-600s1c1
Sequence:CCGGCATCGGTTTAGGACTTGGAATCTCGAGATTCCAAGTCCTAAACCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027495.2-918s1c1
Sequence:CCGGCCTTGCGGTAATATCTGGAATCTCGAGATTCCAGATATTACCGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027495.2-404s1c1
Sequence:CCGGGCTCCAACTTTGTACCACTTACTCGAGTAAGTGGTACAAAGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-1193s21c1
Sequence:CCGGCATCGCCAACCACTCACTAAGCTCGAGCTTAGTGAGTGGTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027495.4-1501s21c1
Sequence:CCGGTCTGGGAATGAACGGATAAATCTCGAGATTTATCCGTTCATTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-936s21c1
Sequence:CCGGATACTCTACGGATCGACATTTCTCGAGAAATGTCGATCCGTAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027495.4-1715s1c1
Sequence:CCGGGAAATTACCATCCCAATTTATCTCGAGATAAATTGGGATGGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-629s21c1
Sequence:CCGGGGGATCATTTAACACCTTAACCTCGAGGTTAAGGTGTTAAATGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-506s21c1
Sequence:CCGGGATACTGCACTGCCCTAAATTCTCGAGAATTTAGGGCAGTGCAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-1010s21c1
Sequence:CCGGAGGCGCTAGCCAGTATGATTTCTCGAGAAATCATACTGGCTAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027495.4-1647s21c1
Sequence:CCGGGGATCATCCTGTCTAACAATGCTCGAGCATTGTTAGACAGGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027495.4-556s21c1
Sequence:CCGGTTTGGGCAACAGGCAACATTGCTCGAGCAATGTTGCCTGTTGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018342
VALIDATED
TMEM144 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 144
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-640s1c1
Sequence:CCGGGCTGGGCTATCAGTAGTAAGTCTCGAGACTTACTACTGATAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-1239s1c1
Sequence:CCGGCATCATCTTGACTGGAGCCTTCTCGAGAAGGCTCCAGTCAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-400s1c1
Sequence:CCGGGCCTTGGTTGTCAATCTGATACTCGAGTATCAGATTGACAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018342.2-861s1c1
Sequence:CCGGGCCAATCATCTACATCAAGGACTCGAGTCCTTGATGTAGATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-645s1c1
Sequence:CCGGGCTATCAGTAGTAAGTGCTTTCTCGAGAAAGCACTTACTACTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018342.2-1576s1c1
Sequence:CCGGCCACAGTATGTACCTAGTGTTCTCGAGAACACTAGGTACATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-836s1c1
Sequence:CCGGGAGTACTCTATGGATCTACATCTCGAGATGTAGATCCATAGAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1772s21c1
Sequence:CCGGGTTTATGAAGGTAGTACTTTACTCGAGTAAAGTACTACCTTCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1917s21c1
Sequence:CCGGGTCCATATTTCTCACCTATTACTCGAGTAATAGGTGAGAAATATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018342.4-789s21c1
Sequence:CCGGGTTTAGGCCTTGGAATCTTAACTCGAGTTAAGATTCCAAGGCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1670s21c1
Sequence:CCGGCACTGTTGGAGTGGGTAAATGCTCGAGCATTTACCCACTCCAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018342
VALIDATED
TMEM144 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 144
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-640s1c1
Sequence:CCGGGCTGGGCTATCAGTAGTAAGTCTCGAGACTTACTACTGATAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-1239s1c1
Sequence:CCGGCATCATCTTGACTGGAGCCTTCTCGAGAAGGCTCCAGTCAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-400s1c1
Sequence:CCGGGCCTTGGTTGTCAATCTGATACTCGAGTATCAGATTGACAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018342.2-861s1c1
Sequence:CCGGGCCAATCATCTACATCAAGGACTCGAGTCCTTGATGTAGATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-645s1c1
Sequence:CCGGGCTATCAGTAGTAAGTGCTTTCTCGAGAAAGCACTTACTACTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018342.2-1576s1c1
Sequence:CCGGCCACAGTATGTACCTAGTGTTCTCGAGAACACTAGGTACATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-836s1c1
Sequence:CCGGGAGTACTCTATGGATCTACATCTCGAGATGTAGATCCATAGAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1772s21c1
Sequence:CCGGGTTTATGAAGGTAGTACTTTACTCGAGTAAAGTACTACCTTCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1917s21c1
Sequence:CCGGGTCCATATTTCTCACCTATTACTCGAGTAATAGGTGAGAAATATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018342.4-789s21c1
Sequence:CCGGGTTTAGGCCTTGGAATCTTAACTCGAGTTAAGATTCCAAGGCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1670s21c1
Sequence:CCGGCACTGTTGGAGTGGGTAAATGCTCGAGCATTTACCCACTCCAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018342
VALIDATED
TMEM144 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 144
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-640s1c1
Sequence:CCGGGCTGGGCTATCAGTAGTAAGTCTCGAGACTTACTACTGATAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-1239s1c1
Sequence:CCGGCATCATCTTGACTGGAGCCTTCTCGAGAAGGCTCCAGTCAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-400s1c1
Sequence:CCGGGCCTTGGTTGTCAATCTGATACTCGAGTATCAGATTGACAACCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018342.2-861s1c1
Sequence:CCGGGCCAATCATCTACATCAAGGACTCGAGTCCTTGATGTAGATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-645s1c1
Sequence:CCGGGCTATCAGTAGTAAGTGCTTTCTCGAGAAAGCACTTACTACTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018342.2-1576s1c1
Sequence:CCGGCCACAGTATGTACCTAGTGTTCTCGAGAACACTAGGTACATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018342.2-836s1c1
Sequence:CCGGGAGTACTCTATGGATCTACATCTCGAGATGTAGATCCATAGAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1772s21c1
Sequence:CCGGGTTTATGAAGGTAGTACTTTACTCGAGTAAAGTACTACCTTCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1917s21c1
Sequence:CCGGGTCCATATTTCTCACCTATTACTCGAGTAATAGGTGAGAAATATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018342.4-789s21c1
Sequence:CCGGGTTTAGGCCTTGGAATCTTAACTCGAGTTAAGATTCCAAGGCCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018342.4-1670s21c1
Sequence:CCGGCACTGTTGGAGTGGGTAAATGCTCGAGCATTTACCCACTCCAACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks