EMAIL THIS PAGE TO A FRIEND

TMEM145

transmembrane protein 145

UniProtKB ID: Q8NBT3
Gene ID:
Mouse(330485) transmembrane protein 145
Rat(292722) transmembrane protein 145
Zebrafish(557826) transmembrane protein 145
domestic cat(101085937) transmembrane protein 145
cow(513015) transmembrane protein 145
sheep(101123320) transmembrane protein 145
domestic guinea pig(100722600) transmembrane protein 145
naked mole-rat(101711057) transmembrane protein 145
Domestic Rabbit(100356757) transmembrane protein 145
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136021 MISSION® esiRNA esiRNA human TMEM145 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173633 Rosetta Predictions human pricing
XR_006067 Rosetta Predictions rat pricing
XR_009141 Rosetta Predictions rat pricing
NM_183311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171829 predicted 479
2 SASI_Hs02_00368514 predicted 349
3 SASI_Hs01_00171830 predicted 611
4 SASI_Hs02_00368515 predicted 1103
5 SASI_Hs02_00368516 predicted 345
6 SASI_Hs02_00368517 predicted 961
7 SASI_Hs01_00171833 predicted 1111
8 SASI_Hs01_00171834 predicted 379
9 SASI_Hs02_00368518 predicted 1132
10 SASI_Hs02_00368519 predicted 1098
11 SASI_Hs01_00171831 predicted 609
12 SASI_Hs01_00171832 predicted 1263
13 SASI_Hs01_00171835 predicted 879
14 SASI_Hs01_00171836 predicted 338
15 SASI_Hs01_00171837 predicted 1396
16 SASI_Hs01_00171838 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125844 predicted 2065
2 SASI_Rn01_00125845 predicted 258
3 SASI_Rn01_00125846 predicted 797
4 SASI_Rn01_00125847 predicted 2126
5 SASI_Rn01_00125849 predicted 1393
6 SASI_Rn01_00125850 predicted 801
7 SASI_Rn01_00125851 predicted 202
8 SASI_Rn01_00125852 predicted 1692
9 SASI_Rn01_00125853 predicted 351
10 SASI_Rn02_00410920 predicted 609
11 SASI_Rn01_00125848 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168762 predicted 1308
2 SASI_Rn01_00168764 predicted 1394
3 SASI_Rn02_00418883 predicted 1151
4 SASI_Rn01_00168765 predicted 1228
5 SASI_Rn01_00168766 predicted 1181
6 SASI_Rn01_00168767 predicted 1010
7 SASI_Rn01_00168768 predicted 1028
8 SASI_Rn01_00168769 predicted 982
9 SASI_Rn01_00168770 predicted 1066
10 SASI_Rn02_00418884 predicted 916
11 SASI_Rn01_00168763 predicted 1214
12 SASI_Rn01_00168771 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077518 predicted 860
2 SASI_Mm01_00077520 predicted 1308
3 SASI_Mm01_00077521 predicted 1389
4 SASI_Mm01_00077522 predicted 545
5 SASI_Mm01_00077523 predicted 771
6 SASI_Mm01_00077524 predicted 1691
7 SASI_Mm01_00077525 predicted 470
8 SASI_Mm01_00077526 predicted 354
9 SASI_Mm01_00077527 predicted 1153
10 SASI_Mm02_00350426 predicted 260
11 SASI_Mm01_00077519 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173633
TMEM145 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 145
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173633.2-1375s21c1
Sequence:CCGGCTATGGGAACGTGACGTTTATCTCGAGATAAACGTCACGTTCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173633.2-532s21c1
Sequence:CCGGACGACACTTCTCCGCTGATGACTCGAGTCATCAGCGGAGAAGTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-795s1c1
Sequence:CCGGCTCATCTTCCTGCTGATGCTTCTCGAGAAGCATCAGCAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-1139s1c1
Sequence:CCGGCCTGATTGCCAATTTCGGCATCTCGAGATGCCGAAATTGGCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-593s1c1
Sequence:CCGGCTTCTTCCTCTCTTGTTACTTCTCGAGAAGTAACAAGAGAGGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-1220s1c1
Sequence:CCGGCCATGGCGTGTTTCTGATCATCTCGAGATGATCAGAAACACGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-636s1c1
Sequence:CCGGCAGTTGCTCCACACAACTTATCTCGAGATAAGTTGTGTGGAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173633.1-247s1c1
Sequence:CCGGGTCAGAACATCCTCCTCTATTCTCGAGAATAGAGGAGGATGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173633
TMEM145 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 145
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173633.2-1375s21c1
Sequence:CCGGCTATGGGAACGTGACGTTTATCTCGAGATAAACGTCACGTTCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173633.2-532s21c1
Sequence:CCGGACGACACTTCTCCGCTGATGACTCGAGTCATCAGCGGAGAAGTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-795s1c1
Sequence:CCGGCTCATCTTCCTGCTGATGCTTCTCGAGAAGCATCAGCAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-1139s1c1
Sequence:CCGGCCTGATTGCCAATTTCGGCATCTCGAGATGCCGAAATTGGCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-593s1c1
Sequence:CCGGCTTCTTCCTCTCTTGTTACTTCTCGAGAAGTAACAAGAGAGGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-1220s1c1
Sequence:CCGGCCATGGCGTGTTTCTGATCATCTCGAGATGATCAGAAACACGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-636s1c1
Sequence:CCGGCAGTTGCTCCACACAACTTATCTCGAGATAAGTTGTGTGGAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173633.1-247s1c1
Sequence:CCGGGTCAGAACATCCTCCTCTATTCTCGAGAATAGAGGAGGATGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173633
TMEM145 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 145
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173633.2-1375s21c1
Sequence:CCGGCTATGGGAACGTGACGTTTATCTCGAGATAAACGTCACGTTCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173633.2-532s21c1
Sequence:CCGGACGACACTTCTCCGCTGATGACTCGAGTCATCAGCGGAGAAGTGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-795s1c1
Sequence:CCGGCTCATCTTCCTGCTGATGCTTCTCGAGAAGCATCAGCAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-1139s1c1
Sequence:CCGGCCTGATTGCCAATTTCGGCATCTCGAGATGCCGAAATTGGCAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-593s1c1
Sequence:CCGGCTTCTTCCTCTCTTGTTACTTCTCGAGAAGTAACAAGAGAGGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-1220s1c1
Sequence:CCGGCCATGGCGTGTTTCTGATCATCTCGAGATGATCAGAAACACGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173633.1-636s1c1
Sequence:CCGGCAGTTGCTCCACACAACTTATCTCGAGATAAGTTGTGTGGAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173633.1-247s1c1
Sequence:CCGGGTCAGAACATCCTCCTCTATTCTCGAGAATAGAGGAGGATGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183311
TMEM145 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 145
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.2-659s1c1
Sequence:CCGGCTCTTGTTACTTTGGATATTTCTCGAGAAATATCCAAAGTAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.2-480s1c1
Sequence:CCGGCGTGAAAGATGGTGGTATATCCTCGAGGATATACCACCATCTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183311.2-2119s21c1
Sequence:CCGGCACTGTTTAGAGACGGATATTCTCGAGAATATCCGTCTCTAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-480s21c1
Sequence:CCGGCGTGAAAGATGGTGGTATATCCTCGAGGATATACCACCATCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-1004s21c1
Sequence:CCGGTGACCCAGGCCAGGTACTATACTCGAGTATAGTACCTGGCCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-1270s21c1
Sequence:CCGGTCTATGCCCATGGCGTGTTTCCTCGAGGAAACACGCCATGGGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-2120s1c1
Sequence:CCGGGCCACTGTTTAGAGACGGATACTCGAGTATCCGTCTCTAAACAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-1232s1c1
Sequence:CCGGGAGAGAAGATAGTCAACGGTACTCGAGTACCGTTGACTATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-2145s1c1
Sequence:CCGGGAAGTTGGTCTCTACTTTGAACTCGAGTTCAAAGTAGAGACCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183311
TMEM145 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 145
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.2-659s1c1
Sequence:CCGGCTCTTGTTACTTTGGATATTTCTCGAGAAATATCCAAAGTAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.2-480s1c1
Sequence:CCGGCGTGAAAGATGGTGGTATATCCTCGAGGATATACCACCATCTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183311.2-2119s21c1
Sequence:CCGGCACTGTTTAGAGACGGATATTCTCGAGAATATCCGTCTCTAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-480s21c1
Sequence:CCGGCGTGAAAGATGGTGGTATATCCTCGAGGATATACCACCATCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-1004s21c1
Sequence:CCGGTGACCCAGGCCAGGTACTATACTCGAGTATAGTACCTGGCCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-1270s21c1
Sequence:CCGGTCTATGCCCATGGCGTGTTTCCTCGAGGAAACACGCCATGGGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-2120s1c1
Sequence:CCGGGCCACTGTTTAGAGACGGATACTCGAGTATCCGTCTCTAAACAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-1232s1c1
Sequence:CCGGGAGAGAAGATAGTCAACGGTACTCGAGTACCGTTGACTATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-2145s1c1
Sequence:CCGGGAAGTTGGTCTCTACTTTGAACTCGAGTTCAAAGTAGAGACCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183311
TMEM145 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 145
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.2-659s1c1
Sequence:CCGGCTCTTGTTACTTTGGATATTTCTCGAGAAATATCCAAAGTAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.2-480s1c1
Sequence:CCGGCGTGAAAGATGGTGGTATATCCTCGAGGATATACCACCATCTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183311.2-2119s21c1
Sequence:CCGGCACTGTTTAGAGACGGATATTCTCGAGAATATCCGTCTCTAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-480s21c1
Sequence:CCGGCGTGAAAGATGGTGGTATATCCTCGAGGATATACCACCATCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-1004s21c1
Sequence:CCGGTGACCCAGGCCAGGTACTATACTCGAGTATAGTACCTGGCCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183311.2-1270s21c1
Sequence:CCGGTCTATGCCCATGGCGTGTTTCCTCGAGGAAACACGCCATGGGCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-2120s1c1
Sequence:CCGGGCCACTGTTTAGAGACGGATACTCGAGTATCCGTCTCTAAACAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-1232s1c1
Sequence:CCGGGAGAGAAGATAGTCAACGGTACTCGAGTACCGTTGACTATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183311.1-2145s1c1
Sequence:CCGGGAAGTTGGTCTCTACTTTGAACTCGAGTTCAAAGTAGAGACCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks