EMAIL THIS PAGE TO A FRIEND

TMEM147

transmembrane protein 147

Synonyms: NIFIE14
UniProtKB ID: Q9BVK8, A8MWW0, O75790
Gene ID:
Mouse(69804) transmembrane protein 147
Rat(292792) transmembrane protein 147
Zebrafish(436757) transmembrane protein 147
domestic cat(101099763) transmembrane protein 147
dog(476482) transmembrane protein 147-like
naked mole-rat(101724959) transmembrane protein 147
domestic guinea pig(100730811) transmembrane protein 147
cow(535038) transmembrane protein 147
sheep(101114801) transmembrane protein 147
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301547 ANTI-TMEM147 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB2700055 Anti-TMEM147 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106889 Anti-TMEM147 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, horse, human, rat
ELISA, western blot pricing
SAB3500638 Anti-TMEM147 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032635 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032635 Rosetta Predictions human pricing
NM_001038494 Rosetta Predictions rat pricing
NM_027215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360187 predicted 336
2 SASI_Hs01_00192760 predicted 464
3 SASI_Hs01_00192761 predicted 468
4 SASI_Hs01_00192762 predicted 505
5 SASI_Hs01_00192763 predicted 332
6 SASI_Hs01_00192764 predicted 348
7 SASI_Hs01_00192765 predicted 356
8 SASI_Hs01_00192766 predicted 346
9 SASI_Hs01_00192767 predicted 421
10 SASI_Hs02_00360188 predicted 360
11 SASI_Hs01_00192759 predicted 430
12 SASI_Hs01_00192768 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084945 predicted 221
2 SASI_Rn01_00084946 predicted 474
3 SASI_Rn01_00084947 predicted 537
4 SASI_Rn01_00084948 predicted 478
5 SASI_Rn01_00084949 predicted 233
6 SASI_Rn01_00084950 predicted 341
7 SASI_Rn01_00084951 predicted 430
8 SASI_Rn02_00204672 predicted 525
9 SASI_Rn01_00084952 predicted 575
10 SASI_Rn01_00084954 predicted 353
11 SASI_Rn01_00084953 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331763 predicted 281
2 SASI_Mm02_00331764 predicted 479
3 SASI_Mm01_00183235 predicted 487
4 SASI_Mm02_00331765 predicted 228
5 SASI_Mm01_00183236 predicted 441
6 SASI_Mm01_00183237 predicted 363
7 SASI_Mm02_00331766 predicted 615
8 SASI_Mm02_00331767 predicted 542
9 SASI_Mm01_00183243 predicted 346
10 SASI_Mm02_00331768 predicted 604
11 SASI_Mm01_00183238 predicted 393
12 SASI_Mm01_00183239 predicted 327
13 SASI_Mm01_00183240 predicted 440
14 SASI_Mm01_00183241 predicted 426
15 SASI_Mm01_00183242 predicted 438
16 SASI_Mm01_00183244 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027215
VALIDATED
TMEM147 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 147
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-581s1c1
Sequence:CCGGCCTGATGTTCCTTAGTGTCTACTCGAGTAGACACTAAGGAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-203s1c1
Sequence:CCGGGCAGCTATGCAAGATGTTGTTCTCGAGAACAACATCTTGCATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027215.1-584s1c1
Sequence:CCGGGATGTTCCTTAGTGTCTACAACTCGAGTTGTAGACACTAAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-206s1c1
Sequence:CCGGGCTATGCAAGATGTTGTTCTTCTCGAGAAGAACAACATCTTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-563s21c1
Sequence:CCGGCAGCTCAGGTCTGGATGATAACTCGAGTTATCATCCAGACCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-478s21c1
Sequence:CCGGGGAGCCCGAGGCATTGAATTTCTCGAGAAATTCAATGCCTCGGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-252s21c1
Sequence:CCGGGCTATGCAAGATGTTGTTCTTCTCGAGAAGAACAACATCTTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-349s21c1
Sequence:CCGGGCAGACCTGATAGGCCTAAACCTCGAGGTTTAGGCCTATCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-161s21c1
Sequence:CCGGCCTATTTCATCACGTACAAATCTCGAGATTTGTACGTGATGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027215
VALIDATED
TMEM147 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 147
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-581s1c1
Sequence:CCGGCCTGATGTTCCTTAGTGTCTACTCGAGTAGACACTAAGGAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-203s1c1
Sequence:CCGGGCAGCTATGCAAGATGTTGTTCTCGAGAACAACATCTTGCATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027215.1-584s1c1
Sequence:CCGGGATGTTCCTTAGTGTCTACAACTCGAGTTGTAGACACTAAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-206s1c1
Sequence:CCGGGCTATGCAAGATGTTGTTCTTCTCGAGAAGAACAACATCTTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-563s21c1
Sequence:CCGGCAGCTCAGGTCTGGATGATAACTCGAGTTATCATCCAGACCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-478s21c1
Sequence:CCGGGGAGCCCGAGGCATTGAATTTCTCGAGAAATTCAATGCCTCGGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-252s21c1
Sequence:CCGGGCTATGCAAGATGTTGTTCTTCTCGAGAAGAACAACATCTTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-349s21c1
Sequence:CCGGGCAGACCTGATAGGCCTAAACCTCGAGGTTTAGGCCTATCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-161s21c1
Sequence:CCGGCCTATTTCATCACGTACAAATCTCGAGATTTGTACGTGATGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027215
VALIDATED
TMEM147 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 147
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-581s1c1
Sequence:CCGGCCTGATGTTCCTTAGTGTCTACTCGAGTAGACACTAAGGAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-203s1c1
Sequence:CCGGGCAGCTATGCAAGATGTTGTTCTCGAGAACAACATCTTGCATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027215.1-584s1c1
Sequence:CCGGGATGTTCCTTAGTGTCTACAACTCGAGTTGTAGACACTAAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027215.1-206s1c1
Sequence:CCGGGCTATGCAAGATGTTGTTCTTCTCGAGAAGAACAACATCTTGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-563s21c1
Sequence:CCGGCAGCTCAGGTCTGGATGATAACTCGAGTTATCATCCAGACCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-478s21c1
Sequence:CCGGGGAGCCCGAGGCATTGAATTTCTCGAGAAATTCAATGCCTCGGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-252s21c1
Sequence:CCGGGCTATGCAAGATGTTGTTCTTCTCGAGAAGAACAACATCTTGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-349s21c1
Sequence:CCGGGCAGACCTGATAGGCCTAAACCTCGAGGTTTAGGCCTATCAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027215.2-161s21c1
Sequence:CCGGCCTATTTCATCACGTACAAATCTCGAGATTTGTACGTGATGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006326
VALIDATED
TMEM147 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 147
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-498s1c1
Sequence:CCGGGAAGTACATCCAGATGAGCATCTCGAGATGCTCATCTGGATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-351s1c1
Sequence:CCGGGATAGGTCTAAACCTTGTCATCTCGAGATGACAAGGTTTAGACCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-387s1c1
Sequence:CCGGCAAGGGAGAGTACAAGATCATCTCGAGATGATCTTGTACTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-155s1c1
Sequence:CCGGCCTACTTCATCACCTACAAGTCTCGAGACTTGTAGGTGATGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-394s1c1
Sequence:CCGGGAGTACAAGATCATGGTTGCTCTCGAGAGCAACCATGATCTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006326
VALIDATED
TMEM147 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 147
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-498s1c1
Sequence:CCGGGAAGTACATCCAGATGAGCATCTCGAGATGCTCATCTGGATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-351s1c1
Sequence:CCGGGATAGGTCTAAACCTTGTCATCTCGAGATGACAAGGTTTAGACCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-387s1c1
Sequence:CCGGCAAGGGAGAGTACAAGATCATCTCGAGATGATCTTGTACTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-155s1c1
Sequence:CCGGCCTACTTCATCACCTACAAGTCTCGAGACTTGTAGGTGATGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-394s1c1
Sequence:CCGGGAGTACAAGATCATGGTTGCTCTCGAGAGCAACCATGATCTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006326
VALIDATED
TMEM147 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 147
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-498s1c1
Sequence:CCGGGAAGTACATCCAGATGAGCATCTCGAGATGCTCATCTGGATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-351s1c1
Sequence:CCGGGATAGGTCTAAACCTTGTCATCTCGAGATGACAAGGTTTAGACCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-387s1c1
Sequence:CCGGCAAGGGAGAGTACAAGATCATCTCGAGATGATCTTGTACTCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-155s1c1
Sequence:CCGGCCTACTTCATCACCTACAAGTCTCGAGACTTGTAGGTGATGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006326.1-394s1c1
Sequence:CCGGGAGTACAAGATCATGGTTGCTCTCGAGAGCAACCATGATCTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032635
VALIDATED
TMEM147 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 147
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032635.2-376s21c1
Sequence:CCGGCAAGGGAGAGTACAAGATCATCTCGAGATGATCTTGTACTCTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-487s21c1
Sequence:CCGGGAAGTACATCCAGATGAGCATCTCGAGATGCTCATCTGGATGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-144s21c1
Sequence:CCGGCCTACTTCATCACCTACAAGTCTCGAGACTTGTAGGTGATGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-340s21c1
Sequence:CCGGGATAGGTCTAAACCTTGTCATCTCGAGATGACAAGGTTTAGACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032635
VALIDATED
TMEM147 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 147
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032635.2-376s21c1
Sequence:CCGGCAAGGGAGAGTACAAGATCATCTCGAGATGATCTTGTACTCTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-487s21c1
Sequence:CCGGGAAGTACATCCAGATGAGCATCTCGAGATGCTCATCTGGATGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-144s21c1
Sequence:CCGGCCTACTTCATCACCTACAAGTCTCGAGACTTGTAGGTGATGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-340s21c1
Sequence:CCGGGATAGGTCTAAACCTTGTCATCTCGAGATGACAAGGTTTAGACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032635
VALIDATED
TMEM147 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 147
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032635.2-376s21c1
Sequence:CCGGCAAGGGAGAGTACAAGATCATCTCGAGATGATCTTGTACTCTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-487s21c1
Sequence:CCGGGAAGTACATCCAGATGAGCATCTCGAGATGCTCATCTGGATGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-144s21c1
Sequence:CCGGCCTACTTCATCACCTACAAGTCTCGAGACTTGTAGGTGATGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032635.2-340s21c1
Sequence:CCGGGATAGGTCTAAACCTTGTCATCTCGAGATGACAAGGTTTAGACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks