EMAIL THIS PAGE TO A FRIEND

TMEM14A

transmembrane protein 14A

Synonyms: C6orf73
UniProtKB ID: Q9Y6G1, B2R552
Gene ID:
Mouse(75712) transmembrane protein 14A
Rat(363206) transmembrane protein 14A
cow(510383) transmembrane protein 14A
sheep(101105448) transmembrane protein 14A
domestic guinea pig(100730940) transmembrane protein 14A
naked mole-rat(101715803) transmembrane protein 14A
chicken(421897) transmembrane protein 14A
domestic cat(101084541) transmembrane protein 14A
dog(474937) transmembrane protein 14A
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA072536 Anti-TMEM14A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014051 Rosetta Predictions human pricing
NM_001108790 Rosetta Predictions rat pricing
NM_029398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038029 predicted 793
2 SASI_Hs02_00345063 predicted 203
3 SASI_Hs01_00038030 predicted 764
4 SASI_Hs01_00038031 predicted 780
5 SASI_Hs01_00038033 predicted 238
6 SASI_Hs01_00038034 predicted 768
7 SASI_Hs02_00345064 predicted 205
8 SASI_Hs01_00038035 predicted 288
9 SASI_Hs01_00038036 predicted 774
10 SASI_Hs01_00038037 predicted 238
11 SASI_Hs01_00038032 predicted 219
12 SASI_Hs01_00038038 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242095 predicted 622
2 SASI_Rn02_00242096 predicted 604
3 SASI_Rn02_00242097 predicted 674
4 SASI_Rn02_00242098 predicted 674
5 SASI_Rn02_00242099 predicted 611
6 SASI_Rn02_00242100 predicted 666
7 SASI_Rn02_00242101 predicted 468
8 SASI_Rn02_00242102 predicted 300
9 SASI_Rn02_00242103 predicted 771
10 SASI_Rn02_00242104 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150743 predicted 778
2 SASI_Mm01_00150744 predicted 459
3 SASI_Mm01_00150745 predicted 478
4 SASI_Mm01_00150746 predicted 461
5 SASI_Mm01_00150747 predicted 421
6 SASI_Mm01_00150750 predicted 448
7 SASI_Mm01_00150751 predicted 490
8 SASI_Mm01_00150752 predicted 820
9 SASI_Mm02_00335295 predicted 452
10 SASI_Mm02_00335296 predicted 756
11 SASI_Mm01_00150748 predicted 814
12 SASI_Mm01_00150749 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014051
VALIDATED
TMEM14A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 14A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014051.3-594s21c1
Sequence:CCGGGTCACCTCTAATATGAACATTCTCGAGAATGTTCATATTAGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-255s21c1
Sequence:CCGGCCGTCTTTGATTGCTGGTCTTCTCGAGAAGACCAGCAATCAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-316s21c1
Sequence:CCGGCCAATGACAAACGAGATGTAACTCGAGTTACATCTCGTTTGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-383s21c1
Sequence:CCGGGAGATTTAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014051.2-573s1c1
Sequence:CCGGGTCACCTCTAATATGAACATTCTCGAGAATGTTCATATTAGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014051.2-234s1c1
Sequence:CCGGCCGTCTTTGATTGCTGGTCTTCTCGAGAAGACCAGCAATCAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014051.2-185s1c1
Sequence:CCGGCCTCGTGACATTTGGAAGCATCTCGAGATGCTTCCAAATGTCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014051.2-362s1c1
Sequence:CCGGGAGATTTAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014051.2-295s1c1
Sequence:CCGGCCAATGACAAACGAGATGTAACTCGAGTTACATCTCGTTTGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014051
VALIDATED
TMEM14A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 14A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014051.3-594s21c1
Sequence:CCGGGTCACCTCTAATATGAACATTCTCGAGAATGTTCATATTAGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-255s21c1
Sequence:CCGGCCGTCTTTGATTGCTGGTCTTCTCGAGAAGACCAGCAATCAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-316s21c1
Sequence:CCGGCCAATGACAAACGAGATGTAACTCGAGTTACATCTCGTTTGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-383s21c1
Sequence:CCGGGAGATTTAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014051.2-573s1c1
Sequence:CCGGGTCACCTCTAATATGAACATTCTCGAGAATGTTCATATTAGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014051.2-234s1c1
Sequence:CCGGCCGTCTTTGATTGCTGGTCTTCTCGAGAAGACCAGCAATCAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014051.2-185s1c1
Sequence:CCGGCCTCGTGACATTTGGAAGCATCTCGAGATGCTTCCAAATGTCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014051.2-362s1c1
Sequence:CCGGGAGATTTAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014051.2-295s1c1
Sequence:CCGGCCAATGACAAACGAGATGTAACTCGAGTTACATCTCGTTTGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014051
VALIDATED
TMEM14A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 14A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014051.3-594s21c1
Sequence:CCGGGTCACCTCTAATATGAACATTCTCGAGAATGTTCATATTAGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-255s21c1
Sequence:CCGGCCGTCTTTGATTGCTGGTCTTCTCGAGAAGACCAGCAATCAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-316s21c1
Sequence:CCGGCCAATGACAAACGAGATGTAACTCGAGTTACATCTCGTTTGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014051.3-383s21c1
Sequence:CCGGGAGATTTAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014051.2-573s1c1
Sequence:CCGGGTCACCTCTAATATGAACATTCTCGAGAATGTTCATATTAGAGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014051.2-234s1c1
Sequence:CCGGCCGTCTTTGATTGCTGGTCTTCTCGAGAAGACCAGCAATCAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014051.2-185s1c1
Sequence:CCGGCCTCGTGACATTTGGAAGCATCTCGAGATGCTTCCAAATGTCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014051.2-362s1c1
Sequence:CCGGGAGATTTAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014051.2-295s1c1
Sequence:CCGGCCAATGACAAACGAGATGTAACTCGAGTTACATCTCGTTTGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029398
VALIDATED
TMEM14A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 14A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029398.2-404s21c1
Sequence:CCGGCTACCGTGTCTCCAATGACAGCTCGAGCTGTCATTGGAGACACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-661s21c1
Sequence:CCGGCATGGGAAATGTCTTATATTGCTCGAGCAATATAAGACATTTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-346s21c1
Sequence:CCGGGTGGAGTTCCATCTCTGATTGCTCGAGCAATCAGAGATGGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029398.2-514s21c1
Sequence:CCGGCTGGTCTAGTTGCAGGCTTAACTCGAGTTAAGCCTGCAACTAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-430s21c1
Sequence:CCGGATGTCAAAGTGTCATTGTTTACTCGAGTAAACAATGACACTTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175182    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029398.1-945s1c1
Sequence:CCGGCCTGCTCTTTAATGCATTGTTCTCGAGAACAATGCATTAAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029398.1-411s1c1
Sequence:CCGGGTCATTGTTTACAGCTTTCTTCTCGAGAAGAAAGCTGTAAACAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029398.1-277s1c1
Sequence:CCGGCTTGTGACAATTGGGAGTGTTCTCGAGAACACTCCCAATTGTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029398
VALIDATED
TMEM14A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 14A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029398.2-404s21c1
Sequence:CCGGCTACCGTGTCTCCAATGACAGCTCGAGCTGTCATTGGAGACACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-661s21c1
Sequence:CCGGCATGGGAAATGTCTTATATTGCTCGAGCAATATAAGACATTTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-346s21c1
Sequence:CCGGGTGGAGTTCCATCTCTGATTGCTCGAGCAATCAGAGATGGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029398.2-514s21c1
Sequence:CCGGCTGGTCTAGTTGCAGGCTTAACTCGAGTTAAGCCTGCAACTAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-430s21c1
Sequence:CCGGATGTCAAAGTGTCATTGTTTACTCGAGTAAACAATGACACTTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175182    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029398.1-945s1c1
Sequence:CCGGCCTGCTCTTTAATGCATTGTTCTCGAGAACAATGCATTAAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029398.1-411s1c1
Sequence:CCGGGTCATTGTTTACAGCTTTCTTCTCGAGAAGAAAGCTGTAAACAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029398.1-277s1c1
Sequence:CCGGCTTGTGACAATTGGGAGTGTTCTCGAGAACACTCCCAATTGTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029398
VALIDATED
TMEM14A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 14A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029398.2-404s21c1
Sequence:CCGGCTACCGTGTCTCCAATGACAGCTCGAGCTGTCATTGGAGACACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-661s21c1
Sequence:CCGGCATGGGAAATGTCTTATATTGCTCGAGCAATATAAGACATTTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-346s21c1
Sequence:CCGGGTGGAGTTCCATCTCTGATTGCTCGAGCAATCAGAGATGGAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029398.2-514s21c1
Sequence:CCGGCTGGTCTAGTTGCAGGCTTAACTCGAGTTAAGCCTGCAACTAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029398.2-430s21c1
Sequence:CCGGATGTCAAAGTGTCATTGTTTACTCGAGTAAACAATGACACTTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175182    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029398.1-945s1c1
Sequence:CCGGCCTGCTCTTTAATGCATTGTTCTCGAGAACAATGCATTAAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029398.1-411s1c1
Sequence:CCGGGTCATTGTTTACAGCTTTCTTCTCGAGAAGAAAGCTGTAAACAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029398.1-277s1c1
Sequence:CCGGCTTGTGACAATTGGGAGTGTTCTCGAGAACACTCCCAATTGTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks