EMAIL THIS PAGE TO A FRIEND

TMEM14B

transmembrane protein 14B

Species: Human TMEM14B(81853)
UniProtKB ID: Q9NUH8, Q5THN7, Q5THN8, Q96IX7, Q9BVN8
Gene ID:
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301463 ANTI-TMEM14B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030969 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127711 Rosetta Predictions human pricing
NM_030969 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330314 predicted 260
2 SASI_Hs02_00330315 predicted 260
3 SASI_Hs02_00330316 predicted 257
4 SASI_Hs02_00330317 predicted 295
5 SASI_Hs02_00330318 predicted 277
6 SASI_Hs02_00330319 predicted 296
7 SASI_Hs02_00330320 predicted 280
8 SASI_Hs02_00330321 predicted 286
9 SASI_Hs02_00330322 predicted 286
10 SASI_Hs02_00330323 predicted 173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358556 predicted 303
2 SASI_Hs02_00358557 predicted 306
3 SASI_Hs02_00358558 predicted 306
4 SASI_Hs01_00022801 predicted 220
5 SASI_Hs02_00358559 predicted 337
6 SASI_Hs02_00358560 predicted 330
7 SASI_Hs02_00358561 predicted 344
8 SASI_Hs02_00358562 predicted 334
9 SASI_Hs02_00358563 predicted 340
10 SASI_Hs02_00358564 predicted 328
11 SASI_Hs01_00022802 predicted 647
12 SASI_Hs01_00022803 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030969
VALIDATED
TMEM14B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 14B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-431s1c1
Sequence:CCGGCGTATGTTGATGACATCTGATCTCGAGATCAGATGTCATCAACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-310s1c1
Sequence:CCGGAGCCGCTACATCTGTTACTTTCTCGAGAAAGTAACAGATGTAGCGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-349s1c1
Sequence:CCGGGAGATCCTACTACTATGGAAACTCGAGTTTCCATAGTAGTAGGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030969.2-136s1c1
Sequence:CCGGGCCTTTGCATTGGTTTGGCTTCTCGAGAAGCCAAACCAATGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-215s21c1
Sequence:CCGGCTACACAGCACTGGTTGTTTCCTCGAGGAAACAACCAGTGCTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-441s21c1
Sequence:CCGGTTAATTGCAGGTGCCAGTTTGCTCGAGCAAACTGGCACCTGCAATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-425s21c1
Sequence:CCGGATTCATGCCTGTAGGTTTAATCTCGAGATTAAACCTACAGGCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-400s21c1
Sequence:CCGGGAATGAGATCCTACTACTATGCTCGAGCATAGTAGTAGGATCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-239s21c1
Sequence:CCGGTGGGATCGTTGGCTATGTAAACTCGAGTTTACATAGCCAACGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-335s21c1
Sequence:CCGGTCAGGATCCAAGGAACGTTTGCTCGAGCAAACGTTCCTTGGATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030969
VALIDATED
TMEM14B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 14B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-431s1c1
Sequence:CCGGCGTATGTTGATGACATCTGATCTCGAGATCAGATGTCATCAACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-310s1c1
Sequence:CCGGAGCCGCTACATCTGTTACTTTCTCGAGAAAGTAACAGATGTAGCGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-349s1c1
Sequence:CCGGGAGATCCTACTACTATGGAAACTCGAGTTTCCATAGTAGTAGGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030969.2-136s1c1
Sequence:CCGGGCCTTTGCATTGGTTTGGCTTCTCGAGAAGCCAAACCAATGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-215s21c1
Sequence:CCGGCTACACAGCACTGGTTGTTTCCTCGAGGAAACAACCAGTGCTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-441s21c1
Sequence:CCGGTTAATTGCAGGTGCCAGTTTGCTCGAGCAAACTGGCACCTGCAATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-425s21c1
Sequence:CCGGATTCATGCCTGTAGGTTTAATCTCGAGATTAAACCTACAGGCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-400s21c1
Sequence:CCGGGAATGAGATCCTACTACTATGCTCGAGCATAGTAGTAGGATCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-239s21c1
Sequence:CCGGTGGGATCGTTGGCTATGTAAACTCGAGTTTACATAGCCAACGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-335s21c1
Sequence:CCGGTCAGGATCCAAGGAACGTTTGCTCGAGCAAACGTTCCTTGGATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030969
VALIDATED
TMEM14B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 14B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-431s1c1
Sequence:CCGGCGTATGTTGATGACATCTGATCTCGAGATCAGATGTCATCAACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-310s1c1
Sequence:CCGGAGCCGCTACATCTGTTACTTTCTCGAGAAAGTAACAGATGTAGCGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030969.2-349s1c1
Sequence:CCGGGAGATCCTACTACTATGGAAACTCGAGTTTCCATAGTAGTAGGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030969.2-136s1c1
Sequence:CCGGGCCTTTGCATTGGTTTGGCTTCTCGAGAAGCCAAACCAATGCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-215s21c1
Sequence:CCGGCTACACAGCACTGGTTGTTTCCTCGAGGAAACAACCAGTGCTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-441s21c1
Sequence:CCGGTTAATTGCAGGTGCCAGTTTGCTCGAGCAAACTGGCACCTGCAATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-425s21c1
Sequence:CCGGATTCATGCCTGTAGGTTTAATCTCGAGATTAAACCTACAGGCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-400s21c1
Sequence:CCGGGAATGAGATCCTACTACTATGCTCGAGCATAGTAGTAGGATCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-239s21c1
Sequence:CCGGTGGGATCGTTGGCTATGTAAACTCGAGTTTACATAGCCAACGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030969.3-335s21c1
Sequence:CCGGTCAGGATCCAAGGAACGTTTGCTCGAGCAAACGTTCCTTGGATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks