EMAIL THIS PAGE TO A FRIEND

TMEM14C

transmembrane protein 14C

Synonyms: C6orf53 MSTP073 NET26 bA421M1.6
UniProtKB ID: Q9P0S9, Q5T4I6
Gene ID:
Mouse(66154) transmembrane protein 14C
Rat(171432) transmembrane protein 14C
Zebrafish(751728) transmembrane protein 14C
chicken(420851) transmembrane protein 14C
dog(478720) transmembrane protein 14C
domestic cat(101094418) transmembrane protein 14C
naked mole-rat(101700400) transmembrane protein 14C
domestic guinea pig(100714477) transmembrane protein 14C
cow(613802) transmembrane protein 14C
sheep(101106042) transmembrane protein 14C
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016462 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016462 Rosetta Predictions human pricing
NM_134395 Rosetta Predictions rat pricing
XM_579636 Rosetta Predictions rat pricing
NM_025387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108796 predicted 404
2 SASI_Hs01_00108797 predicted 391
3 SASI_Hs01_00108798 predicted 397
4 SASI_Hs01_00108799 predicted 400
5 SASI_Hs01_00108800 predicted 384
6 SASI_Hs01_00108801 predicted 192
7 SASI_Hs01_00108802 predicted 696
8 SASI_Hs01_00108803 predicted 533
9 SASI_Hs01_00108804 predicted 409
10 SASI_Hs01_00108805 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034941 predicted 408
2 SASI_Rn01_00034942 predicted 356
3 SASI_Rn01_00034944 predicted 418
4 SASI_Rn01_00034945 predicted 362
5 SASI_Rn01_00034946 predicted 458
6 SASI_Rn01_00034947 predicted 366
7 SASI_Rn01_00034948 predicted 416
8 SASI_Rn01_00034949 predicted 459
9 SASI_Rn01_00034950 predicted 349
10 SASI_Rn02_00267964 predicted 396
11 SASI_Rn01_00034943 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160941 predicted 405
2 SASI_Rn01_00160942 predicted 412
3 SASI_Rn01_00160943 predicted 402
4 SASI_Rn01_00160944 predicted 410
5 SASI_Rn01_00160945 predicted 405
6 SASI_Rn01_00160946 predicted 418
7 SASI_Rn01_00160947 predicted 551
8 SASI_Rn01_00160948 predicted 562
9 SASI_Rn01_00160949 predicted 593
10 SASI_Rn01_00160950 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122192 predicted 203
2 SASI_Mm01_00122193 predicted 502
3 SASI_Mm01_00122194 predicted 525
4 SASI_Mm02_00328120 predicted 533
5 SASI_Mm01_00122195 predicted 612
6 SASI_Mm01_00122197 predicted 538
7 SASI_Mm01_00122198 predicted 451
8 SASI_Mm01_00122199 predicted 427
9 SASI_Mm01_00122200 predicted 552
10 SASI_Mm02_00328121 predicted 436
11 SASI_Mm01_00122196 predicted 610
12 SASI_Mm01_00122201 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025387
VALIDATED
TMEM14C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 14C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-259s21c1
Sequence:CCGGGTGGGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-383s21c1
Sequence:CCGGCCTAGCTACATCTGGGACCTTCTCGAGAAGGTCCCAGATGTAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-474s21c1
Sequence:CCGGAGTTTGCTGATGGTTGCCAAACTCGAGTTTGGCAACCATCAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025387.3-577s21c1
Sequence:CCGGCCTCCACATTACAATGTTGAACTCGAGTTCAACATTGTAATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025387.1-537s1c1
Sequence:CCGGCCTCCACATTACAATGTTGAACTCGAGTTCAACATTGTAATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025387.1-343s1c1
Sequence:CCGGCCTAGCTACATCTGGGACCTTCTCGAGAAGGTCCCAGATGTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-219s1c1
Sequence:CCGGGTGGGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-451s1c1
Sequence:CCGGCAAAGTTGGAATTAGTCTGTTCTCGAGAACAGACTAATTCCAACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-434s1c1
Sequence:CCGGAGTTTGCTGATGGTTGCCAAACTCGAGTTTGGCAACCATCAGCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025387
VALIDATED
TMEM14C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 14C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-259s21c1
Sequence:CCGGGTGGGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-383s21c1
Sequence:CCGGCCTAGCTACATCTGGGACCTTCTCGAGAAGGTCCCAGATGTAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-474s21c1
Sequence:CCGGAGTTTGCTGATGGTTGCCAAACTCGAGTTTGGCAACCATCAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025387.3-577s21c1
Sequence:CCGGCCTCCACATTACAATGTTGAACTCGAGTTCAACATTGTAATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025387.1-537s1c1
Sequence:CCGGCCTCCACATTACAATGTTGAACTCGAGTTCAACATTGTAATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025387.1-343s1c1
Sequence:CCGGCCTAGCTACATCTGGGACCTTCTCGAGAAGGTCCCAGATGTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-219s1c1
Sequence:CCGGGTGGGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-451s1c1
Sequence:CCGGCAAAGTTGGAATTAGTCTGTTCTCGAGAACAGACTAATTCCAACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-434s1c1
Sequence:CCGGAGTTTGCTGATGGTTGCCAAACTCGAGTTTGGCAACCATCAGCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025387
VALIDATED
TMEM14C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 14C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-259s21c1
Sequence:CCGGGTGGGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-383s21c1
Sequence:CCGGCCTAGCTACATCTGGGACCTTCTCGAGAAGGTCCCAGATGTAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025387.3-474s21c1
Sequence:CCGGAGTTTGCTGATGGTTGCCAAACTCGAGTTTGGCAACCATCAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025387.3-577s21c1
Sequence:CCGGCCTCCACATTACAATGTTGAACTCGAGTTCAACATTGTAATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025387.1-537s1c1
Sequence:CCGGCCTCCACATTACAATGTTGAACTCGAGTTCAACATTGTAATGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025387.1-343s1c1
Sequence:CCGGCCTAGCTACATCTGGGACCTTCTCGAGAAGGTCCCAGATGTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-219s1c1
Sequence:CCGGGTGGGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-451s1c1
Sequence:CCGGCAAAGTTGGAATTAGTCTGTTCTCGAGAACAGACTAATTCCAACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025387.1-434s1c1
Sequence:CCGGAGTTTGCTGATGGTTGCCAAACTCGAGTTTGGCAACCATCAGCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016462
VALIDATED
TMEM14C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 14C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-376s1c1
Sequence:CCGGCCTAGCTACATCTGGTACCTTCTCGAGAAGGTACCAGATGTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-717s1c1
Sequence:CCGGGAGCTTAATAAGACCCTCATACTCGAGTATGAGGGTCTTATTAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-481s1c1
Sequence:CCGGCGCCAAAGTTGGAGTTAGTATCTCGAGATACTAACTCCAACTTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-415s1c1
Sequence:CCGGGAGGTTCTACCACTCTGGAAACTCGAGTTTCCAGAGTGGTAGAACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-403s1c1
Sequence:CCGGCATTATGGGAATGAGGTTCTACTCGAGTAGAACCTCATTCCCATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016462
VALIDATED
TMEM14C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 14C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-376s1c1
Sequence:CCGGCCTAGCTACATCTGGTACCTTCTCGAGAAGGTACCAGATGTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-717s1c1
Sequence:CCGGGAGCTTAATAAGACCCTCATACTCGAGTATGAGGGTCTTATTAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-481s1c1
Sequence:CCGGCGCCAAAGTTGGAGTTAGTATCTCGAGATACTAACTCCAACTTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-415s1c1
Sequence:CCGGGAGGTTCTACCACTCTGGAAACTCGAGTTTCCAGAGTGGTAGAACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-403s1c1
Sequence:CCGGCATTATGGGAATGAGGTTCTACTCGAGTAGAACCTCATTCCCATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016462
VALIDATED
TMEM14C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 14C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-376s1c1
Sequence:CCGGCCTAGCTACATCTGGTACCTTCTCGAGAAGGTACCAGATGTAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-717s1c1
Sequence:CCGGGAGCTTAATAAGACCCTCATACTCGAGTATGAGGGTCTTATTAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-481s1c1
Sequence:CCGGCGCCAAAGTTGGAGTTAGTATCTCGAGATACTAACTCCAACTTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-415s1c1
Sequence:CCGGGAGGTTCTACCACTCTGGAAACTCGAGTTTCCAGAGTGGTAGAACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016462.2-403s1c1
Sequence:CCGGCATTATGGGAATGAGGTTCTACTCGAGTAGAACCTCATTCCCATAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks