EMAIL THIS PAGE TO A FRIEND

TMEM14E

transmembrane protein 14E

Species: Human TMEM14E(645843)
UniProtKB ID: Q6UXP3
Gene ID:
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123228 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227351 MISSION® esiRNA esiRNA targeting human TMEM14E human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123228 Rosetta Predictions human pricing
XM_930419 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327755 predicted 257
2 SASI_Hs02_00327756 predicted 268
3 SASI_Hs02_00327757 predicted 251
4 SASI_Hs02_00327758 predicted 271
5 SASI_Hs02_00327759 predicted 292
6 SASI_Hs02_00327760 predicted 299
7 SASI_Hs02_00327761 predicted 295
8 SASI_Hs02_00327762 predicted 267
9 SASI_Hs02_00327763 predicted 251
10 SASI_Hs02_00327764 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287435 predicted 254
2 SASI_Hs01_00287436 predicted 272
3 SASI_Hs01_00287437 predicted 247
4 SASI_Hs01_00287438 predicted 262
5 SASI_Hs01_00287439 predicted 286
6 SASI_Hs01_00287440 predicted 295
7 SASI_Hs01_00287441 predicted 295
8 SASI_Hs01_00287442 predicted 264
9 SASI_Hs01_00287443 predicted 297
10 SASI_Hs01_00287444 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123228
TMEM14E MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 14E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-368s21c1
Sequence:CCGGCAGGTGCCTGCTGATAGTTTCCTCGAGGAAACTATCAGCAGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-329s21c1
Sequence:CCGGTCTAACACTCTGGAACATTTACTCGAGTAAATGTTCCAGAGTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123228.1-495s21c1
Sequence:CCGGACTCTGAGAAATAAGTCTATACTCGAGTATAGACTTATTTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-305s21c1
Sequence:CCGGTGCTAGGTATTATGCGAATAACTCGAGTTATTCGCATAATACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-273s21c1
Sequence:CCGGCATTTGAGTTCTCCCGTTTACCTCGAGGTAAACGGGAGAACTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123228
TMEM14E MISSION shRNA shRNA Plasmid DNA
transmembrane protein 14E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-368s21c1
Sequence:CCGGCAGGTGCCTGCTGATAGTTTCCTCGAGGAAACTATCAGCAGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-329s21c1
Sequence:CCGGTCTAACACTCTGGAACATTTACTCGAGTAAATGTTCCAGAGTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123228.1-495s21c1
Sequence:CCGGACTCTGAGAAATAAGTCTATACTCGAGTATAGACTTATTTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-305s21c1
Sequence:CCGGTGCTAGGTATTATGCGAATAACTCGAGTTATTCGCATAATACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-273s21c1
Sequence:CCGGCATTTGAGTTCTCCCGTTTACCTCGAGGTAAACGGGAGAACTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123228
TMEM14E MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 14E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-368s21c1
Sequence:CCGGCAGGTGCCTGCTGATAGTTTCCTCGAGGAAACTATCAGCAGGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-329s21c1
Sequence:CCGGTCTAACACTCTGGAACATTTACTCGAGTAAATGTTCCAGAGTGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123228.1-495s21c1
Sequence:CCGGACTCTGAGAAATAAGTCTATACTCGAGTATAGACTTATTTCTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-305s21c1
Sequence:CCGGTGCTAGGTATTATGCGAATAACTCGAGTTATTCGCATAATACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123228.1-273s21c1
Sequence:CCGGCATTTGAGTTCTCCCGTTTACCTCGAGGTAAACGGGAGAACTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks