EMAIL THIS PAGE TO A FRIEND

TMEM150A

transmembrane protein 150A

Synonyms: TM6P1 TMEM150
UniProtKB ID: Q86TG1, A8K764, B7WPQ9, D6W5L2, Q8N2R6
Gene ID:
Mouse(232086) transmembrane protein 150A
Rat(245966) transmembrane protein 150A
Zebrafish(751697) transmembrane protein 150A
dog(483080) transmembrane protein 150A
chicken(423759) transmembrane protein 150A
domestic cat(101086389) transmembrane protein 150A
cow(515742) transmembrane protein 150A
sheep(101103139) transmembrane protein 150A
domestic guinea pig(100728702) transmembrane protein 150A
naked mole-rat(101701603) transmembrane protein 150A
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031738 Rosetta Predictions human pricing
NM_153342 Rosetta Predictions human pricing
NM_139107 Rosetta Predictions rat pricing
NM_144916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024340 predicted 1244
2 SASI_Hs01_00024341 predicted 1243
3 SASI_Hs01_00024342 predicted 1242
4 SASI_Hs01_00024343 predicted 1037
5 SASI_Hs01_00024344 predicted 1127
6 SASI_Hs01_00024346 predicted 1214
7 SASI_Hs01_00024347 predicted 1249
8 SASI_Hs01_00024348 predicted 1032
9 SASI_Hs01_00024349 predicted 1112
10 SASI_Hs02_00307797 predicted 1064
11 SASI_Hs01_00024345 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112924 predicted 1211
2 SASI_Hs01_00112925 predicted 1211
3 SASI_Hs01_00112926 predicted 1212
4 SASI_Hs01_00112927 predicted 1009
5 SASI_Hs01_00112928 predicted 1096
6 SASI_Hs01_00112930 predicted 1186
7 SASI_Hs01_00112931 predicted 1213
8 SASI_Hs01_00112932 predicted 1003
9 SASI_Hs01_00112933 predicted 1084
10 SASI_Hs02_00367200 predicted 1041
11 SASI_Hs01_00112929 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075052 predicted 866
2 SASI_Rn01_00075053 predicted 908
3 SASI_Rn01_00075054 predicted 1039
4 SASI_Rn01_00075055 predicted 223
5 SASI_Rn02_00268484 predicted 385
6 SASI_Rn01_00075056 predicted 450
7 SASI_Rn01_00075057 predicted 492
8 SASI_Rn02_00268485 predicted 438
9 SASI_Rn01_00075058 predicted 218
10 SASI_Rn01_00075059 predicted 525
11 SASI_Rn01_00075060 predicted 795
12 SASI_Rn01_00075061 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101756 predicted 849
2 SASI_Mm01_00101757 predicted 235
3 SASI_Mm01_00101758 predicted 504
4 SASI_Mm01_00101759 predicted 1190
5 SASI_Mm01_00101760 predicted 428
6 SASI_Mm01_00101761 predicted 516
7 SASI_Mm01_00101762 predicted 969
8 SASI_Mm01_00101763 predicted 1091
9 SASI_Mm01_00101764 predicted 433
10 SASI_Mm01_00101765 predicted 955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031738
TMEM150A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 150A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-877s21c1
Sequence:CCGGGCACCTTCAGCTACGAGTTTGCTCGAGCAAACTCGTAGCTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-311s21c1
Sequence:CCGGTGTGGAGAACTGGTCCTACAACTCGAGTTGTAGGACCAGTTCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-287s21c1
Sequence:CCGGTGTGATGAACCACCATGTATGCTCGAGCATACATGGTGGTTCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-1006s21c1
Sequence:CCGGAGAGCATCGCTATGATCTAAGCTCGAGCTTAGATCATAGCGATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-222s1c1
Sequence:CCGGGCATATGGACTGTGTATGCCACTCGAGTGGCATACACAGTCCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-761s1c1
Sequence:CCGGCATGAGAGTTCTCAGCTGCAACTCGAGTTGCAGCTGAGAACTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-207s1c1
Sequence:CCGGCGTTCTCCATCACTGGCATATCTCGAGATATGCCAGTGATGGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-626s1c1
Sequence:CCGGCTCTTTGTTTGCCTGCACTGTCTCGAGACAGTGCAGGCAAACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-542s1c1
Sequence:CCGGCTCTTGGTGGTTGGCAACTTTCTCGAGAAAGTTGCCAACCACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-551s1c1
Sequence:CCGGGTTGGCAACTTTCAGGTGGATCTCGAGATCCACCTGAAAGTTGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031738
TMEM150A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 150A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-877s21c1
Sequence:CCGGGCACCTTCAGCTACGAGTTTGCTCGAGCAAACTCGTAGCTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-311s21c1
Sequence:CCGGTGTGGAGAACTGGTCCTACAACTCGAGTTGTAGGACCAGTTCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-287s21c1
Sequence:CCGGTGTGATGAACCACCATGTATGCTCGAGCATACATGGTGGTTCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-1006s21c1
Sequence:CCGGAGAGCATCGCTATGATCTAAGCTCGAGCTTAGATCATAGCGATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-222s1c1
Sequence:CCGGGCATATGGACTGTGTATGCCACTCGAGTGGCATACACAGTCCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-761s1c1
Sequence:CCGGCATGAGAGTTCTCAGCTGCAACTCGAGTTGCAGCTGAGAACTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-207s1c1
Sequence:CCGGCGTTCTCCATCACTGGCATATCTCGAGATATGCCAGTGATGGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-626s1c1
Sequence:CCGGCTCTTTGTTTGCCTGCACTGTCTCGAGACAGTGCAGGCAAACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-542s1c1
Sequence:CCGGCTCTTGGTGGTTGGCAACTTTCTCGAGAAAGTTGCCAACCACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-551s1c1
Sequence:CCGGGTTGGCAACTTTCAGGTGGATCTCGAGATCCACCTGAAAGTTGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031738
TMEM150A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 150A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-877s21c1
Sequence:CCGGGCACCTTCAGCTACGAGTTTGCTCGAGCAAACTCGTAGCTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-311s21c1
Sequence:CCGGTGTGGAGAACTGGTCCTACAACTCGAGTTGTAGGACCAGTTCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-287s21c1
Sequence:CCGGTGTGATGAACCACCATGTATGCTCGAGCATACATGGTGGTTCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031738.2-1006s21c1
Sequence:CCGGAGAGCATCGCTATGATCTAAGCTCGAGCTTAGATCATAGCGATGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-222s1c1
Sequence:CCGGGCATATGGACTGTGTATGCCACTCGAGTGGCATACACAGTCCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-761s1c1
Sequence:CCGGCATGAGAGTTCTCAGCTGCAACTCGAGTTGCAGCTGAGAACTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-207s1c1
Sequence:CCGGCGTTCTCCATCACTGGCATATCTCGAGATATGCCAGTGATGGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031738.1-626s1c1
Sequence:CCGGCTCTTTGTTTGCCTGCACTGTCTCGAGACAGTGCAGGCAAACAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-542s1c1
Sequence:CCGGCTCTTGGTGGTTGGCAACTTTCTCGAGAAAGTTGCCAACCACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031738.1-551s1c1
Sequence:CCGGGTTGGCAACTTTCAGGTGGATCTCGAGATCCACCTGAAAGTTGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144916
VALIDATED
TMEM150A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 150A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144916.3-283s21c1
Sequence:CCGGTGGAGAACTGGTCCTACAATGCTCGAGCATTGTAGGACCAGTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144916.3-855s21c1
Sequence:CCGGAGCTATGAGTTCGGGACAATCCTCGAGGATTGTCCCGAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144916.3-217s21c1
Sequence:CCGGCCTTCTCCATCACCGGCATATCTCGAGATATGCCGGTGATGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144916.3-812s21c1
Sequence:CCGGATGGGTGTTTGTCCTCGATATCTCGAGATATCGAGGACAAACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144916.3-1194s21c1
Sequence:CCGGCCCTCATACCAGAGTAGTATTCTCGAGAATACTACTCTGGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144916.1-358s1c1
Sequence:CCGGCCTGGATGATGTTCCTCTCATCTCGAGATGAGAGGAACATCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144916.1-1204s1c2
Sequence:CCGGCCAGAGTAGTATTCTGTGTTACTCGAGTAACACAGAATACTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144916.1-508s1c1
Sequence:CCGGGATCAATACCACTGCACTCATCTCGAGATGAGTGCAGTGGTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144916
VALIDATED
TMEM150A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 150A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144916.3-283s21c1
Sequence:CCGGTGGAGAACTGGTCCTACAATGCTCGAGCATTGTAGGACCAGTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144916.3-855s21c1
Sequence:CCGGAGCTATGAGTTCGGGACAATCCTCGAGGATTGTCCCGAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144916.3-217s21c1
Sequence:CCGGCCTTCTCCATCACCGGCATATCTCGAGATATGCCGGTGATGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144916.3-812s21c1
Sequence:CCGGATGGGTGTTTGTCCTCGATATCTCGAGATATCGAGGACAAACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144916.3-1194s21c1
Sequence:CCGGCCCTCATACCAGAGTAGTATTCTCGAGAATACTACTCTGGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144916.1-358s1c1
Sequence:CCGGCCTGGATGATGTTCCTCTCATCTCGAGATGAGAGGAACATCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144916.1-1204s1c2
Sequence:CCGGCCAGAGTAGTATTCTGTGTTACTCGAGTAACACAGAATACTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144916.1-508s1c1
Sequence:CCGGGATCAATACCACTGCACTCATCTCGAGATGAGTGCAGTGGTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144916
VALIDATED
TMEM150A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 150A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144916.3-283s21c1
Sequence:CCGGTGGAGAACTGGTCCTACAATGCTCGAGCATTGTAGGACCAGTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144916.3-855s21c1
Sequence:CCGGAGCTATGAGTTCGGGACAATCCTCGAGGATTGTCCCGAACTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144916.3-217s21c1
Sequence:CCGGCCTTCTCCATCACCGGCATATCTCGAGATATGCCGGTGATGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144916.3-812s21c1
Sequence:CCGGATGGGTGTTTGTCCTCGATATCTCGAGATATCGAGGACAAACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144916.3-1194s21c1
Sequence:CCGGCCCTCATACCAGAGTAGTATTCTCGAGAATACTACTCTGGTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144916.1-358s1c1
Sequence:CCGGCCTGGATGATGTTCCTCTCATCTCGAGATGAGAGGAACATCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144916.1-1204s1c2
Sequence:CCGGCCAGAGTAGTATTCTGTGTTACTCGAGTAACACAGAATACTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144916.1-508s1c1
Sequence:CCGGGATCAATACCACTGCACTCATCTCGAGATGAGTGCAGTGGTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153342
TMEM150A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 150A
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153342.1-737s1c1
Sequence:CCGGGAGAGTTCTCAGCTGCAACATCTCGAGATGTTGCAGCTGAGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153342.1-454s1c1
Sequence:CCGGGAGTCGGCACTCTTGGGTTAACTCGAGTTAACCCAAGAGTGCCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153342
TMEM150A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 150A
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153342.1-737s1c1
Sequence:CCGGGAGAGTTCTCAGCTGCAACATCTCGAGATGTTGCAGCTGAGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153342.1-454s1c1
Sequence:CCGGGAGTCGGCACTCTTGGGTTAACTCGAGTTAACCCAAGAGTGCCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153342
TMEM150A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 150A
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153342.1-737s1c1
Sequence:CCGGGAGAGTTCTCAGCTGCAACATCTCGAGATGTTGCAGCTGAGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153342.1-454s1c1
Sequence:CCGGGAGTCGGCACTCTTGGGTTAACTCGAGTTAACCCAAGAGTGCCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks