EMAIL THIS PAGE TO A FRIEND

TMEM150B

transmembrane protein 150B

Synonyms: TMEM224
UniProtKB ID: A6NC51, B7ZW71
Gene ID:
Mouse(330460) transmembrane protein 150B
Rat(308346) transmembrane protein 150B
naked mole-rat(101720176) transmembrane protein 150B
domestic guinea pig(100712989) transmembrane protein 150B
cow(515527) transmembrane protein 150B
sheep(101121193) transmembrane protein 150B
domestic cat(101091574) transmembrane protein 150B
dog(611328) transmembrane protein 150B
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001085488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085488 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091391 MISSION® esiRNA esiRNA targeting mouse Tmem224 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085488 Rosetta Predictions human pricing
XM_209187 Rosetta Predictions human pricing
NM_001107476 Rosetta Predictions rat pricing
NM_177887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317986 predicted 420
2 SASI_Hs02_00317987 predicted 262
3 SASI_Hs02_00317988 predicted 428
4 SASI_Hs02_00317989 predicted 265
5 SASI_Hs02_00317990 predicted 374
6 SASI_Hs02_00317991 predicted 193
7 SASI_Hs02_00317992 predicted 436
8 SASI_Hs02_00317993 predicted 217
9 SASI_Hs02_00317994 predicted 479
10 SASI_Hs02_00317995 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297549 predicted 418
2 SASI_Hs01_00297550 predicted 255
3 SASI_Hs01_00297551 predicted 428
4 SASI_Hs01_00297552 predicted 264
5 SASI_Hs01_00297553 predicted 367
6 SASI_Hs01_00297554 predicted 436
7 SASI_Hs01_00297555 predicted 217
8 SASI_Hs01_00297556 predicted 478
9 SASI_Hs01_00297557 predicted 417
10 SASI_Hs01_00297558 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229205 predicted 1015
2 SASI_Rn02_00229206 predicted 308
3 SASI_Rn02_00229207 predicted 860
4 SASI_Rn02_00229208 predicted 761
5 SASI_Rn02_00229209 predicted 497
6 SASI_Rn02_00229210 predicted 383
7 SASI_Rn02_00229211 predicted 833
8 SASI_Rn02_00229212 predicted 1022
9 SASI_Rn02_00229213 predicted 679
10 SASI_Rn02_00229214 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066127 predicted 1107
2 SASI_Mm01_00066128 predicted 1084
3 SASI_Mm01_00066129 predicted 930
4 SASI_Mm01_00066130 predicted 1012
5 SASI_Mm01_00066131 predicted 841
6 SASI_Mm01_00066132 predicted 907
7 SASI_Mm01_00066133 predicted 906
8 SASI_Mm01_00066134 predicted 1109
9 SASI_Mm01_00066135 predicted 317
10 SASI_Mm01_00066136 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177887
TMEM150B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 150B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-462s1c1
Sequence:CCGGGAGCTGCTCTAACTGTTTGGACTCGAGTCCAAACAGTTAGAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-351s1c1
Sequence:CCGGCAATCGCTGTGGTTAATGGTTCTCGAGAACCATTAACCACAGCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-470s1c1
Sequence:CCGGCTAACTGTTTGGATCTGCATTCTCGAGAATGCAGATCCAAACAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177887.3-1779s1c1
Sequence:CCGGGAGTAGTCAACACTTACTTATCTCGAGATAAGTAAGTGTTGACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-439s21c1
Sequence:CCGGTTCGGCCAAGTCCTCAATATACTCGAGTATATTGAGGACTTGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-347s21c1
Sequence:CCGGTTGCAATCGCTGTGGTTAATGCTCGAGCATTAACCACAGCGATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-400s21c1
Sequence:CCGGATCAGTATCTGTGGCTCTTATCTCGAGATAAGAGCCACAGATACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177887.4-1779s21c1
Sequence:CCGGGAGTAGTCAACACTTACTTATCTCGAGATAAGTAAGTGTTGACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-635s21c1
Sequence:CCGGCTCACCGGAGATGAGAGTAAACTCGAGTTTACTCTCATCTCCGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177887
TMEM150B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 150B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-462s1c1
Sequence:CCGGGAGCTGCTCTAACTGTTTGGACTCGAGTCCAAACAGTTAGAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-351s1c1
Sequence:CCGGCAATCGCTGTGGTTAATGGTTCTCGAGAACCATTAACCACAGCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-470s1c1
Sequence:CCGGCTAACTGTTTGGATCTGCATTCTCGAGAATGCAGATCCAAACAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177887.3-1779s1c1
Sequence:CCGGGAGTAGTCAACACTTACTTATCTCGAGATAAGTAAGTGTTGACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-439s21c1
Sequence:CCGGTTCGGCCAAGTCCTCAATATACTCGAGTATATTGAGGACTTGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-347s21c1
Sequence:CCGGTTGCAATCGCTGTGGTTAATGCTCGAGCATTAACCACAGCGATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-400s21c1
Sequence:CCGGATCAGTATCTGTGGCTCTTATCTCGAGATAAGAGCCACAGATACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177887.4-1779s21c1
Sequence:CCGGGAGTAGTCAACACTTACTTATCTCGAGATAAGTAAGTGTTGACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-635s21c1
Sequence:CCGGCTCACCGGAGATGAGAGTAAACTCGAGTTTACTCTCATCTCCGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177887
TMEM150B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 150B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-462s1c1
Sequence:CCGGGAGCTGCTCTAACTGTTTGGACTCGAGTCCAAACAGTTAGAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-351s1c1
Sequence:CCGGCAATCGCTGTGGTTAATGGTTCTCGAGAACCATTAACCACAGCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177887.2-470s1c1
Sequence:CCGGCTAACTGTTTGGATCTGCATTCTCGAGAATGCAGATCCAAACAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177887.3-1779s1c1
Sequence:CCGGGAGTAGTCAACACTTACTTATCTCGAGATAAGTAAGTGTTGACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-439s21c1
Sequence:CCGGTTCGGCCAAGTCCTCAATATACTCGAGTATATTGAGGACTTGGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-347s21c1
Sequence:CCGGTTGCAATCGCTGTGGTTAATGCTCGAGCATTAACCACAGCGATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-400s21c1
Sequence:CCGGATCAGTATCTGTGGCTCTTATCTCGAGATAAGAGCCACAGATACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177887.4-1779s21c1
Sequence:CCGGGAGTAGTCAACACTTACTTATCTCGAGATAAGTAAGTGTTGACTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177887.4-635s21c1
Sequence:CCGGCTCACCGGAGATGAGAGTAAACTCGAGTTTACTCTCATCTCCGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085488
TMEM150B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 150B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-440s21c1
Sequence:CCGGGATCCTATGGACGGGTCTTCTCTCGAGAGAAGACCCGTCCATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-375s21c1
Sequence:CCGGTGGATCTGCATTGTCCGTTACCTCGAGGTAACGGACAATGCAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-474s21c1
Sequence:CCGGACCTCCGTGGTAGGCAATTTCCTCGAGGAAATTGCCTACCACGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-264s21c1
Sequence:CCGGAGGACTGTGGACCTCAGTAAACTCGAGTTTACTGAGGTCCACAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-336s21c1
Sequence:CCGGTTCAGCCAGGTGCTCAATATGCTCGAGCATATTGAGCACCTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085488
TMEM150B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 150B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-440s21c1
Sequence:CCGGGATCCTATGGACGGGTCTTCTCTCGAGAGAAGACCCGTCCATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-375s21c1
Sequence:CCGGTGGATCTGCATTGTCCGTTACCTCGAGGTAACGGACAATGCAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-474s21c1
Sequence:CCGGACCTCCGTGGTAGGCAATTTCCTCGAGGAAATTGCCTACCACGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-264s21c1
Sequence:CCGGAGGACTGTGGACCTCAGTAAACTCGAGTTTACTGAGGTCCACAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-336s21c1
Sequence:CCGGTTCAGCCAGGTGCTCAATATGCTCGAGCATATTGAGCACCTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085488
TMEM150B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 150B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-440s21c1
Sequence:CCGGGATCCTATGGACGGGTCTTCTCTCGAGAGAAGACCCGTCCATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-375s21c1
Sequence:CCGGTGGATCTGCATTGTCCGTTACCTCGAGGTAACGGACAATGCAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-474s21c1
Sequence:CCGGACCTCCGTGGTAGGCAATTTCCTCGAGGAAATTGCCTACCACGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-264s21c1
Sequence:CCGGAGGACTGTGGACCTCAGTAAACTCGAGTTTACTGAGGTCCACAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085488.1-336s21c1
Sequence:CCGGTTCAGCCAGGTGCTCAATATGCTCGAGCATATTGAGCACCTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks