EMAIL THIS PAGE TO A FRIEND

TMEM150C

transmembrane protein 150C

UniProtKB ID: B9EJG8, B7Z4J5, B7Z4L3, B7Z692, B7Z6X6
Gene ID:
Mouse(231503) transmembrane protein 150C
Rat(360916) transmembrane protein 150C
Zebrafish(100003020) transmembrane protein 150C
domestic cat(101087574) transmembrane protein 150C
dog(608621) transmembrane protein 150C
chicken(422599) transmembrane protein 150C
cow(534560) transmembrane protein 150C
sheep(101115125) transmembrane protein 150C
domestic guinea pig(100729209) transmembrane protein 150C
naked mole-rat(101720883) transmembrane protein 150C
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080506 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080506 Rosetta Predictions human pricing
XM_496707 Rosetta Predictions human pricing
NM_001108354 Rosetta Predictions rat pricing
NM_182841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315497 predicted 299
2 SASI_Hs02_00315498 predicted 671
3 SASI_Hs02_00315499 predicted 577
4 SASI_Hs02_00315500 predicted 410
5 SASI_Hs02_00315501 predicted 557
6 SASI_Hs02_00315502 predicted 1256
7 SASI_Hs02_00315503 predicted 1159
8 SASI_Hs02_00315504 predicted 1242
9 SASI_Hs02_00315505 predicted 478
10 SASI_Hs02_00315506 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301239 predicted 1181
2 SASI_Hs01_00301240 predicted 293
3 SASI_Hs01_00301241 predicted 257
4 SASI_Hs01_00301242 predicted 395
5 SASI_Hs01_00301243 predicted 1137
6 SASI_Hs01_00301244 predicted 620
7 SASI_Hs01_00301245 predicted 545
8 SASI_Hs01_00301246 predicted 1145
9 SASI_Hs01_00301247 predicted 1282
10 SASI_Hs01_00301248 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237839 predicted 456
2 SASI_Rn02_00237840 predicted 312
3 SASI_Rn02_00237841 predicted 1238
4 SASI_Rn02_00237842 predicted 610
5 SASI_Rn02_00237843 predicted 244
6 SASI_Rn02_00237844 predicted 698
7 SASI_Rn02_00237845 predicted 1136
8 SASI_Rn02_00237846 predicted 240
9 SASI_Rn02_00237847 predicted 534
10 SASI_Rn02_00237848 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349981 predicted 1498
2 SASI_Mm01_00075743 predicted 381
3 SASI_Mm01_00075744 predicted 1457
4 SASI_Mm01_00075746 predicted 799
5 SASI_Mm02_00349982 predicted 1530
6 SASI_Mm01_00075747 predicted 392
7 SASI_Mm01_00075748 predicted 900
8 SASI_Mm01_00075749 predicted 755
9 SASI_Mm01_00075750 predicted 638
10 SASI_Mm01_00075751 predicted 685
11 SASI_Mm01_00075745 predicted 498
12 SASI_Mm01_00075752 predicted 546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080506
TMEM150C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 150C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-362s21c1
Sequence:CCGGTAAACCCGTGGCTGAATATTACTCGAGTAATATTCAGCCACGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080506.1-1016s21c1
Sequence:CCGGTGTCGAAATACACGCTGTTACCTCGAGGTAACAGCGTGTATTTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-222s21c1
Sequence:CCGGTGTGAAGCATGCACCATATATCTCGAGATATATGGTGCATGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-323s21c1
Sequence:CCGGTAGCTGTTCTGCGCTTCATACCTCGAGGTATGAAGCGCAGAACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-729s21c1
Sequence:CCGGTTACCGCTATGAGATTGTTTGCTCGAGCAAACAATCTCATAGCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080506
TMEM150C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 150C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-362s21c1
Sequence:CCGGTAAACCCGTGGCTGAATATTACTCGAGTAATATTCAGCCACGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080506.1-1016s21c1
Sequence:CCGGTGTCGAAATACACGCTGTTACCTCGAGGTAACAGCGTGTATTTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-222s21c1
Sequence:CCGGTGTGAAGCATGCACCATATATCTCGAGATATATGGTGCATGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-323s21c1
Sequence:CCGGTAGCTGTTCTGCGCTTCATACCTCGAGGTATGAAGCGCAGAACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-729s21c1
Sequence:CCGGTTACCGCTATGAGATTGTTTGCTCGAGCAAACAATCTCATAGCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080506
TMEM150C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 150C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-362s21c1
Sequence:CCGGTAAACCCGTGGCTGAATATTACTCGAGTAATATTCAGCCACGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080506.1-1016s21c1
Sequence:CCGGTGTCGAAATACACGCTGTTACCTCGAGGTAACAGCGTGTATTTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-222s21c1
Sequence:CCGGTGTGAAGCATGCACCATATATCTCGAGATATATGGTGCATGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-323s21c1
Sequence:CCGGTAGCTGTTCTGCGCTTCATACCTCGAGGTATGAAGCGCAGAACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080506.1-729s21c1
Sequence:CCGGTTACCGCTATGAGATTGTTTGCTCGAGCAAACAATCTCATAGCGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182841
TMEM150C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 150C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182841.1-383s1c1
Sequence:CCGGGTTTCTACCTCTCGTGTTTACCTCGAGGTAAACACGAGAGGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182841.1-691s1c1
Sequence:CCGGGAATGACCTTACTTGGTAATTCTCGAGAATTACCAAGTAAGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182841.1-2595s1c1
Sequence:CCGGGCACACAGTAAATGTCCAAATCTCGAGATTTGGACATTTACTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182841.1-1063s1c1
Sequence:CCGGGCCTGTCAGAAGCTTCTGAATCTCGAGATTCAGAAGCTTCTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182841.1-2523s1c1
Sequence:CCGGCCCTGAAGTATAGCTTCCCAACTCGAGTTGGGAAGCTATACTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182841.1-1263s1c1
Sequence:CCGGGCAGGTTACTTCTTTCTTGAACTCGAGTTCAAGAAAGAAGTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182841.1-421s1c1
Sequence:CCGGGCTTGTGGATAGTGTACTTTACTCGAGTAAAGTACACTATCCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182841
TMEM150C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 150C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182841.1-383s1c1
Sequence:CCGGGTTTCTACCTCTCGTGTTTACCTCGAGGTAAACACGAGAGGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182841.1-691s1c1
Sequence:CCGGGAATGACCTTACTTGGTAATTCTCGAGAATTACCAAGTAAGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182841.1-2595s1c1
Sequence:CCGGGCACACAGTAAATGTCCAAATCTCGAGATTTGGACATTTACTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182841.1-1063s1c1
Sequence:CCGGGCCTGTCAGAAGCTTCTGAATCTCGAGATTCAGAAGCTTCTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182841.1-2523s1c1
Sequence:CCGGCCCTGAAGTATAGCTTCCCAACTCGAGTTGGGAAGCTATACTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182841.1-1263s1c1
Sequence:CCGGGCAGGTTACTTCTTTCTTGAACTCGAGTTCAAGAAAGAAGTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182841.1-421s1c1
Sequence:CCGGGCTTGTGGATAGTGTACTTTACTCGAGTAAAGTACACTATCCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182841
TMEM150C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 150C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182841.1-383s1c1
Sequence:CCGGGTTTCTACCTCTCGTGTTTACCTCGAGGTAAACACGAGAGGTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182841.1-691s1c1
Sequence:CCGGGAATGACCTTACTTGGTAATTCTCGAGAATTACCAAGTAAGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182841.1-2595s1c1
Sequence:CCGGGCACACAGTAAATGTCCAAATCTCGAGATTTGGACATTTACTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182841.1-1063s1c1
Sequence:CCGGGCCTGTCAGAAGCTTCTGAATCTCGAGATTCAGAAGCTTCTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182841.1-2523s1c1
Sequence:CCGGCCCTGAAGTATAGCTTCCCAACTCGAGTTGGGAAGCTATACTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182841.1-1263s1c1
Sequence:CCGGGCAGGTTACTTCTTTCTTGAACTCGAGTTCAAGAAAGAAGTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182841.1-421s1c1
Sequence:CCGGGCTTGTGGATAGTGTACTTTACTCGAGTAAAGTACACTATCCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks