EMAIL THIS PAGE TO A FRIEND

TMEM151A

transmembrane protein 151A

Synonyms: TMEM151
UniProtKB ID: Q8N4L1, Q8ND14
Gene ID:
Mouse(381199) transmembrane protein 151A
Rat(309158) transmembrane protein 151A
naked mole-rat(101697874) transmembrane protein 151A
domestic guinea pig(100714198) transmembrane protein 151A
cow(618096) transmembrane protein 151A
sheep(101105200) transmembrane protein 151A
dog(483713) transmembrane protein 151A
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153266 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU036251 MISSION® esiRNA esiRNA targeting mouse Tmem151a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153266 Rosetta Predictions human pricing
NM_001107570 Rosetta Predictions rat pricing
NM_001001885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166295 predicted 1944
2 SASI_Hs01_00166296 predicted 2036
3 SASI_Hs01_00166297 predicted 874
4 SASI_Hs01_00166298 predicted 667
5 SASI_Hs01_00166299 predicted 421
6 SASI_Hs02_00367145 predicted 329
7 SASI_Hs01_00166294 predicted 626
8 SASI_Hs01_00166300 predicted 1599
9 SASI_Hs01_00166301 predicted 1477
10 SASI_Hs01_00166303 predicted 1606
11 SASI_Hs01_00166302 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230135 predicted 513
2 SASI_Rn02_00230136 predicted 824
3 SASI_Rn02_00230137 predicted 802
4 SASI_Rn02_00230138 predicted 283
5 SASI_Rn02_00230139 predicted 955
6 SASI_Rn02_00230140 predicted 1026
7 SASI_Rn02_00230141 predicted 943
8 SASI_Rn02_00230142 predicted 396
9 SASI_Rn02_00230143 predicted 1033
10 SASI_Rn02_00230144 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147412 predicted 1134
2 SASI_Mm01_00147414 predicted 1419
3 SASI_Mm01_00147415 predicted 901
4 SASI_Mm01_00147416 predicted 396
5 SASI_Mm01_00147417 predicted 587
6 SASI_Mm02_00286231 predicted 1007
7 SASI_Mm01_00147418 predicted 1630
8 SASI_Mm01_00147419 predicted 1567
9 SASI_Mm01_00147420 predicted 614
10 SASI_Mm01_00147421 predicted 1573
11 SASI_Mm01_00147413 predicted 1698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001885
TMEM151A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 151A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-679s1c1
Sequence:CCGGGAGTTTGACTACAGTGCACATCTCGAGATGTGCACTGTAGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-1431s1c1
Sequence:CCGGCTATGAGGACGCCCTTTACTTCTCGAGAAGTAAAGGGCGTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001885.1-3659s1c1
Sequence:CCGGGCATGGATAGTGTGACATAATCTCGAGATTATGTCACACTATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-882s1c1
Sequence:CCGGGCATCTGAAGGATGTGGACTTCTCGAGAAGTCCACATCCTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001885
TMEM151A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 151A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-679s1c1
Sequence:CCGGGAGTTTGACTACAGTGCACATCTCGAGATGTGCACTGTAGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-1431s1c1
Sequence:CCGGCTATGAGGACGCCCTTTACTTCTCGAGAAGTAAAGGGCGTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001885.1-3659s1c1
Sequence:CCGGGCATGGATAGTGTGACATAATCTCGAGATTATGTCACACTATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-882s1c1
Sequence:CCGGGCATCTGAAGGATGTGGACTTCTCGAGAAGTCCACATCCTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001885
TMEM151A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 151A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-679s1c1
Sequence:CCGGGAGTTTGACTACAGTGCACATCTCGAGATGTGCACTGTAGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-1431s1c1
Sequence:CCGGCTATGAGGACGCCCTTTACTTCTCGAGAAGTAAAGGGCGTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001885.1-3659s1c1
Sequence:CCGGGCATGGATAGTGTGACATAATCTCGAGATTATGTCACACTATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001885.1-882s1c1
Sequence:CCGGGCATCTGAAGGATGTGGACTTCTCGAGAAGTCCACATCCTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153266
TMEM151A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 151A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-886s21c1
Sequence:CCGGCATGCACCTGAAGGACGTAGACTCGAGTCTACGTCCTTCAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-638s21c1
Sequence:CCGGACCACGCAGGTGTACCATGAGCTCGAGCTCATGGTACACCTGCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153266.3-1912s21c1
Sequence:CCGGGTGACGCAGAAGCACAAATTGCTCGAGCAATTTGTGCTTCTGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-1452s21c1
Sequence:CCGGTCTACTTCCCGGTGCTCATTGCTCGAGCAATGAGCACCGGGAAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153266.3-1569s21c1
Sequence:CCGGGCTTAGATGCCCGAGTGATTGCTCGAGCAATCACTCGGGCATCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-394s21c1
Sequence:CCGGCTCCGATGGCTACCTGTACATCTCGAGATGTACAGGTAGCCATCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153266
TMEM151A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 151A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-886s21c1
Sequence:CCGGCATGCACCTGAAGGACGTAGACTCGAGTCTACGTCCTTCAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-638s21c1
Sequence:CCGGACCACGCAGGTGTACCATGAGCTCGAGCTCATGGTACACCTGCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153266.3-1912s21c1
Sequence:CCGGGTGACGCAGAAGCACAAATTGCTCGAGCAATTTGTGCTTCTGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-1452s21c1
Sequence:CCGGTCTACTTCCCGGTGCTCATTGCTCGAGCAATGAGCACCGGGAAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153266.3-1569s21c1
Sequence:CCGGGCTTAGATGCCCGAGTGATTGCTCGAGCAATCACTCGGGCATCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-394s21c1
Sequence:CCGGCTCCGATGGCTACCTGTACATCTCGAGATGTACAGGTAGCCATCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153266
TMEM151A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 151A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-886s21c1
Sequence:CCGGCATGCACCTGAAGGACGTAGACTCGAGTCTACGTCCTTCAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-638s21c1
Sequence:CCGGACCACGCAGGTGTACCATGAGCTCGAGCTCATGGTACACCTGCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153266.3-1912s21c1
Sequence:CCGGGTGACGCAGAAGCACAAATTGCTCGAGCAATTTGTGCTTCTGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-1452s21c1
Sequence:CCGGTCTACTTCCCGGTGCTCATTGCTCGAGCAATGAGCACCGGGAAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153266.3-1569s21c1
Sequence:CCGGGCTTAGATGCCCGAGTGATTGCTCGAGCAATCACTCGGGCATCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153266.3-394s21c1
Sequence:CCGGCTCCGATGGCTACCTGTACATCTCGAGATGTACAGGTAGCCATCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks