EMAIL THIS PAGE TO A FRIEND

TMEM151B

transmembrane protein 151B

Synonyms: C6orf137 TMEM193 bA444E17.5
UniProtKB ID: Q8IW70, Q5T9V7
Gene ID:
Mouse(210573) transmembrane protein 151B
Rat(301253) transmembrane protein 151B
Zebrafish(100006371) transmembrane protein 151B
dog(481820) transmembrane protein 151B
domestic cat(101098055) transmembrane protein 151B
cow(519699) transmembrane protein 151B
sheep(101114474) transmembrane protein 151B
domestic guinea pig(100735761) transmembrane protein 151B
naked mole-rat(101698838) transmembrane protein 151B
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137560 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039704 Rosetta Predictions human pricing
XM_001723534 Rosetta Predictions human pricing
XM_001723740 Rosetta Predictions human pricing
XM_001725716 Rosetta Predictions human pricing
XM_001067417 Rosetta Predictions rat pricing
XM_236940 Rosetta Predictions rat pricing
NM_001013749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038935 predicted 2357
2 SASI_Hs01_00038936 predicted 2293
3 SASI_Hs01_00038937 predicted 2222
4 SASI_Hs01_00038938 predicted 1978
5 SASI_Hs01_00038939 predicted 1518
6 SASI_Hs01_00038940 predicted 1571
7 SASI_Hs01_00038941 predicted 1789
8 SASI_Hs01_00038942 predicted 1595
9 SASI_Hs01_00038943 predicted 1664
10 SASI_Hs01_00038944 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455928 predicted 318
2 SASI_Hs02_00455929 predicted 427
3 SASI_Hs02_00455930 predicted 833
4 SASI_Hs02_00455931 predicted 523
5 SASI_Hs02_00455932 predicted 950
6 SASI_Hs02_00455933 predicted 2186
7 SASI_Hs02_00455934 predicted 1769
8 SASI_Hs02_00455935 predicted 1949
9 SASI_Hs02_00455936 predicted 2067
10 SASI_Hs02_00455937 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00457276 predicted 314
2 SASI_Hs02_00457277 predicted 423
3 SASI_Hs02_00457278 predicted 836
4 SASI_Hs02_00457279 predicted 529
5 SASI_Hs02_00457280 predicted 944
6 SASI_Hs02_00457281 predicted 2179
7 SASI_Hs02_00457282 predicted 1777
8 SASI_Hs02_00457283 predicted 1946
9 SASI_Hs02_00457284 predicted 2067
10 SASI_Hs02_00457285 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00469518 predicted 313
2 SASI_Hs02_00469519 predicted 423
3 SASI_Hs02_00469520 predicted 837
4 SASI_Hs02_00469521 predicted 525
5 SASI_Hs02_00469522 predicted 949
6 SASI_Hs02_00469523 predicted 2187
7 SASI_Hs02_00469524 predicted 1770
8 SASI_Hs02_00469525 predicted 1951
9 SASI_Hs02_00469526 predicted 2074
10 SASI_Hs02_00469527 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320944 predicted 633
2 SASI_Rn02_00320945 predicted 447
3 SASI_Rn02_00320946 predicted 660
4 SASI_Rn02_00320947 predicted 645
5 SASI_Rn02_00320948 predicted 430
6 SASI_Rn02_00320949 predicted 640
7 SASI_Rn02_00320950 predicted 556
8 SASI_Rn02_00320951 predicted 413
9 SASI_Rn02_00320952 predicted 934
10 SASI_Rn02_00320953 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390514 predicted 1321
2 SASI_Rn02_00390515 predicted 267
3 SASI_Rn02_00390516 predicted 1446
4 SASI_Rn02_00390517 predicted 1290
5 SASI_Rn02_00390518 predicted 271
6 SASI_Rn02_00390519 predicted 270
7 SASI_Rn02_00390520 predicted 279
8 SASI_Rn02_00390521 predicted 1398
9 SASI_Rn02_00390522 predicted 1293
10 SASI_Rn02_00390523 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106152 predicted 2154
2 SASI_Mm01_00106153 predicted 685
3 SASI_Mm01_00106154 predicted 1068
4 SASI_Mm01_00106155 predicted 1092
5 SASI_Mm01_00106156 predicted 800
6 SASI_Mm01_00106158 predicted 748
7 SASI_Mm01_00106159 predicted 580
8 SASI_Mm02_00287282 predicted 2008
9 SASI_Mm01_00106160 predicted 2126
10 SASI_Mm01_00106161 predicted 772
11 SASI_Mm01_00106157 predicted 2068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137560
TMEM151B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 151B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-497s21c1
Sequence:CCGGAGGCCATCAGCTACCACTATGCTCGAGCATAGTGGTAGCTGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-578s21c1
Sequence:CCGGTCTACCACGAACGCGTCAACACTCGAGTGTTGACGCGTTCGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-828s21c1
Sequence:CCGGGAACGTGGACTTCCGTGAGTTCTCGAGAACTCACGGAAGTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137560.1-2189s21c1
Sequence:CCGGCTGGATTCCAACTAGCTAATGCTCGAGCATTAGCTAGTTGGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-545s21c1
Sequence:CCGGACCGCAATGGAGACGCCTATACTCGAGTATAGGCGTCTCCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137560
TMEM151B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 151B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-497s21c1
Sequence:CCGGAGGCCATCAGCTACCACTATGCTCGAGCATAGTGGTAGCTGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-578s21c1
Sequence:CCGGTCTACCACGAACGCGTCAACACTCGAGTGTTGACGCGTTCGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-828s21c1
Sequence:CCGGGAACGTGGACTTCCGTGAGTTCTCGAGAACTCACGGAAGTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137560.1-2189s21c1
Sequence:CCGGCTGGATTCCAACTAGCTAATGCTCGAGCATTAGCTAGTTGGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-545s21c1
Sequence:CCGGACCGCAATGGAGACGCCTATACTCGAGTATAGGCGTCTCCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137560
TMEM151B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 151B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-497s21c1
Sequence:CCGGAGGCCATCAGCTACCACTATGCTCGAGCATAGTGGTAGCTGATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-578s21c1
Sequence:CCGGTCTACCACGAACGCGTCAACACTCGAGTGTTGACGCGTTCGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-828s21c1
Sequence:CCGGGAACGTGGACTTCCGTGAGTTCTCGAGAACTCACGGAAGTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137560.1-2189s21c1
Sequence:CCGGCTGGATTCCAACTAGCTAATGCTCGAGCATTAGCTAGTTGGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137560.1-545s21c1
Sequence:CCGGACCGCAATGGAGACGCCTATACTCGAGTATAGGCGTCTCCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013749
TMEM151B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 151B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-750s21c1
Sequence:CCGGTGGTGGAAGGCCATCAGTTATCTCGAGATAACTGATGGCCTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-1419s21c1
Sequence:CCGGTACTCGGAGGTGTTGCTTATGCTCGAGCATAAGCAACACCTCCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-406s21c1
Sequence:CCGGTCCAGCCCTCTTTCACCAAATCTCGAGATTTGGTGAAAGAGGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-1380s21c1
Sequence:CCGGGAGTGGCACATCCGTTCTAATCTCGAGATTAGAACGGATGTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013749.1-3082s21c1
Sequence:CCGGTAGCTAGAGAGATACCCATTTCTCGAGAAATGGGTATCTCTCTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013749
TMEM151B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 151B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-750s21c1
Sequence:CCGGTGGTGGAAGGCCATCAGTTATCTCGAGATAACTGATGGCCTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-1419s21c1
Sequence:CCGGTACTCGGAGGTGTTGCTTATGCTCGAGCATAAGCAACACCTCCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-406s21c1
Sequence:CCGGTCCAGCCCTCTTTCACCAAATCTCGAGATTTGGTGAAAGAGGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-1380s21c1
Sequence:CCGGGAGTGGCACATCCGTTCTAATCTCGAGATTAGAACGGATGTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013749.1-3082s21c1
Sequence:CCGGTAGCTAGAGAGATACCCATTTCTCGAGAAATGGGTATCTCTCTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013749
TMEM151B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 151B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-750s21c1
Sequence:CCGGTGGTGGAAGGCCATCAGTTATCTCGAGATAACTGATGGCCTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-1419s21c1
Sequence:CCGGTACTCGGAGGTGTTGCTTATGCTCGAGCATAAGCAACACCTCCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-406s21c1
Sequence:CCGGTCCAGCCCTCTTTCACCAAATCTCGAGATTTGGTGAAAGAGGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013749.1-1380s21c1
Sequence:CCGGGAGTGGCACATCCGTTCTAATCTCGAGATTAGAACGGATGTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013749.1-3082s21c1
Sequence:CCGGTAGCTAGAGAGATACCCATTTCTCGAGAAATGGGTATCTCTCTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks