EMAIL THIS PAGE TO A FRIEND

TMEM154

transmembrane protein 154

UniProtKB ID: Q6P9G4, Q8WUT7, Q96MQ8
Gene ID:
Mouse(320782) transmembrane protein 154
Rat(361972) transmembrane protein 154
domestic guinea pig(100717306) transmembrane protein 154
cow(510523) transmembrane protein 154
sheep(101104429) transmembrane protein 154
Zebrafish(323681) transmembrane protein 154
chicken(771586) transmembrane protein 154
dog(612458) transmembrane protein 154
205 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152680 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022941 MISSION® esiRNA esiRNA human TMEM154 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152680 Rosetta Predictions human pricing
NM_001108553 Rosetta Predictions rat pricing
NM_177260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213728 predicted 321
2 SASI_Hs01_00213729 predicted 467
3 SASI_Hs01_00213730 predicted 641
4 SASI_Hs01_00213731 predicted 317
5 SASI_Hs01_00213732 predicted 656
6 SASI_Hs01_00213733 predicted 638
7 SASI_Hs01_00213734 predicted 298
8 SASI_Hs01_00213735 predicted 451
9 SASI_Hs01_00213737 predicted 561
10 SASI_Hs02_00366575 predicted 577
11 SASI_Hs01_00213736 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239779 predicted 293
2 SASI_Rn02_00239780 predicted 401
3 SASI_Rn02_00239781 predicted 293
4 SASI_Rn02_00239782 predicted 342
5 SASI_Rn02_00239783 predicted 295
6 SASI_Rn02_00239784 predicted 362
7 SASI_Rn02_00239785 predicted 296
8 SASI_Rn02_00239786 predicted 423
9 SASI_Rn02_00239787 predicted 260
10 SASI_Rn02_00239788 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130740 predicted 359
2 SASI_Mm01_00130741 predicted 629
3 SASI_Mm01_00130742 predicted 216
4 SASI_Mm01_00130743 predicted 366
5 SASI_Mm01_00130744 predicted 625
6 SASI_Mm01_00130745 predicted 994
7 SASI_Mm01_00130746 predicted 515
8 SASI_Mm02_00347299 predicted 360
9 SASI_Mm01_00130747 predicted 693
10 SASI_Mm01_00130748 predicted 773
11 SASI_Mm01_00130749 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177260
TMEM154 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 154
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-311s21c1
Sequence:CCGGACGGTGACCACAGAAGCATTACTCGAGTAATGCTTCTGTGGTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-533s21c1
Sequence:CCGGGAAACCCTGAAAGTCCCTATTCTCGAGAATAGGGACTTTCAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-368s21c1
Sequence:CCGGTCAAACCAGGTGGAATTTATACTCGAGTATAAATTCCACCTGGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-588s21c1
Sequence:CCGGAGATGGAAGAGCTTGATAAATCTCGAGATTTATCAAGCTCTTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-209s21c1
Sequence:CCGGGGTCAATCCAGCCAGGGAAATCTCGAGATTTCCCTGGCTGGATTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177260.2-681s1c1
Sequence:CCGGCCAGCCCAAGTGACAATGAATCTCGAGATTCATTGTCACTTGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177260.2-1668s1c1
Sequence:CCGGGCCATCAGAAATGACATTCTACTCGAGTAGAATGTCATTTCTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-619s1c1
Sequence:CCGGCATGAACAGAAACGCCGACTACTCGAGTAGTCGGCGTTTCTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-633s1c1
Sequence:CCGGCCGACTATGAGTGTTTACCTACTCGAGTAGGTAAACACTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177260.2-318s1c1
Sequence:CCGGCCACAGAAGCATTAGCTGAAACTCGAGTTTCAGCTAATGCTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177260.2-1344s1c1
Sequence:CCGGCGCAGAAGAAATAGCCATCTTCTCGAGAAGATGGCTATTTCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-419s1c1
Sequence:CCGGCTCATCCTTCTATTCATGGTTCTCGAGAACCATGAATAGAAGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177260
TMEM154 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 154
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-311s21c1
Sequence:CCGGACGGTGACCACAGAAGCATTACTCGAGTAATGCTTCTGTGGTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-533s21c1
Sequence:CCGGGAAACCCTGAAAGTCCCTATTCTCGAGAATAGGGACTTTCAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-368s21c1
Sequence:CCGGTCAAACCAGGTGGAATTTATACTCGAGTATAAATTCCACCTGGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-588s21c1
Sequence:CCGGAGATGGAAGAGCTTGATAAATCTCGAGATTTATCAAGCTCTTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-209s21c1
Sequence:CCGGGGTCAATCCAGCCAGGGAAATCTCGAGATTTCCCTGGCTGGATTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177260.2-681s1c1
Sequence:CCGGCCAGCCCAAGTGACAATGAATCTCGAGATTCATTGTCACTTGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177260.2-1668s1c1
Sequence:CCGGGCCATCAGAAATGACATTCTACTCGAGTAGAATGTCATTTCTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-619s1c1
Sequence:CCGGCATGAACAGAAACGCCGACTACTCGAGTAGTCGGCGTTTCTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-633s1c1
Sequence:CCGGCCGACTATGAGTGTTTACCTACTCGAGTAGGTAAACACTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177260.2-318s1c1
Sequence:CCGGCCACAGAAGCATTAGCTGAAACTCGAGTTTCAGCTAATGCTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177260.2-1344s1c1
Sequence:CCGGCGCAGAAGAAATAGCCATCTTCTCGAGAAGATGGCTATTTCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-419s1c1
Sequence:CCGGCTCATCCTTCTATTCATGGTTCTCGAGAACCATGAATAGAAGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177260
TMEM154 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 154
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-311s21c1
Sequence:CCGGACGGTGACCACAGAAGCATTACTCGAGTAATGCTTCTGTGGTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-533s21c1
Sequence:CCGGGAAACCCTGAAAGTCCCTATTCTCGAGAATAGGGACTTTCAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-368s21c1
Sequence:CCGGTCAAACCAGGTGGAATTTATACTCGAGTATAAATTCCACCTGGTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-588s21c1
Sequence:CCGGAGATGGAAGAGCTTGATAAATCTCGAGATTTATCAAGCTCTTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177260.2-209s21c1
Sequence:CCGGGGTCAATCCAGCCAGGGAAATCTCGAGATTTCCCTGGCTGGATTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177260.2-681s1c1
Sequence:CCGGCCAGCCCAAGTGACAATGAATCTCGAGATTCATTGTCACTTGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177260.2-1668s1c1
Sequence:CCGGGCCATCAGAAATGACATTCTACTCGAGTAGAATGTCATTTCTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-619s1c1
Sequence:CCGGCATGAACAGAAACGCCGACTACTCGAGTAGTCGGCGTTTCTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-633s1c1
Sequence:CCGGCCGACTATGAGTGTTTACCTACTCGAGTAGGTAAACACTCATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177260.2-318s1c1
Sequence:CCGGCCACAGAAGCATTAGCTGAAACTCGAGTTTCAGCTAATGCTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177260.2-1344s1c1
Sequence:CCGGCGCAGAAGAAATAGCCATCTTCTCGAGAAGATGGCTATTTCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177260.2-419s1c1
Sequence:CCGGCTCATCCTTCTATTCATGGTTCTCGAGAACCATGAATAGAAGGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152680
VALIDATED
TMEM154 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 154
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152680.1-254s1c1
Sequence:CCGGGCTGCAGTGACCATCAAAGAACTCGAGTTCTTTGATGGTCACTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-521s1c1
Sequence:CCGGCCCTCTGTTATGGAAATTGAACTCGAGTTCAATTTCCATAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-1939s1c1
Sequence:CCGGCCCAAACATTTGCTGCTCAATCTCGAGATTGAGCAGCAAATGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-340s1c1
Sequence:CCGGGATGGTGTTAATCCCATTGATCTCGAGATCAATGGGATTAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152680.1-2913s1c1
Sequence:CCGGCCTCACTAATTTGCCCTAATTCTCGAGAATTAGGGCAAATTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-209s1c1
Sequence:CCGGGTGGAATCTGAAAGACCAAATCTCGAGATTTGGTCTTTCAGATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152680
VALIDATED
TMEM154 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 154
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152680.1-254s1c1
Sequence:CCGGGCTGCAGTGACCATCAAAGAACTCGAGTTCTTTGATGGTCACTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-521s1c1
Sequence:CCGGCCCTCTGTTATGGAAATTGAACTCGAGTTCAATTTCCATAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-1939s1c1
Sequence:CCGGCCCAAACATTTGCTGCTCAATCTCGAGATTGAGCAGCAAATGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-340s1c1
Sequence:CCGGGATGGTGTTAATCCCATTGATCTCGAGATCAATGGGATTAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152680.1-2913s1c1
Sequence:CCGGCCTCACTAATTTGCCCTAATTCTCGAGAATTAGGGCAAATTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-209s1c1
Sequence:CCGGGTGGAATCTGAAAGACCAAATCTCGAGATTTGGTCTTTCAGATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152680
VALIDATED
TMEM154 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 154
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152680.1-254s1c1
Sequence:CCGGGCTGCAGTGACCATCAAAGAACTCGAGTTCTTTGATGGTCACTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-521s1c1
Sequence:CCGGCCCTCTGTTATGGAAATTGAACTCGAGTTCAATTTCCATAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-1939s1c1
Sequence:CCGGCCCAAACATTTGCTGCTCAATCTCGAGATTGAGCAGCAAATGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-340s1c1
Sequence:CCGGGATGGTGTTAATCCCATTGATCTCGAGATCAATGGGATTAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152680.1-2913s1c1
Sequence:CCGGCCTCACTAATTTGCCCTAATTCTCGAGAATTAGGGCAAATTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152680.1-209s1c1
Sequence:CCGGGTGGAATCTGAAAGACCAAATCTCGAGATTTGGTCTTTCAGATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks