EMAIL THIS PAGE TO A FRIEND

TMEM155

transmembrane protein 155

UniProtKB ID: Q4W5P6, D3DNW9, Q96NI2
Gene ID:
domestic cat(101089100) transmembrane protein 155
sheep(101114194) transmembrane protein 155
domestic guinea pig(101787179) transmembrane protein 155
naked mole-rat(101717452) transmembrane protein 155
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152399 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152399 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216107 predicted 1299
2 SASI_Hs01_00216108 predicted 1312
3 SASI_Hs01_00216109 predicted 1316
4 SASI_Hs01_00216111 predicted 1351
5 SASI_Hs01_00216112 predicted 1266
6 SASI_Hs01_00216113 predicted 1275
7 SASI_Hs01_00216110 predicted 561
8 SASI_Hs01_00216114 predicted 1305
9 SASI_Hs01_00216115 predicted 1238
10 SASI_Hs02_00366081 predicted 645
11 SASI_Hs01_00216116 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152399
TMEM155 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 155
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-555s1c1
Sequence:CCGGGCATGCCAGTTCAAATCCACTCTCGAGAGTGGATTTGAACTGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-373s1c1
Sequence:CCGGGATTCTACAGAATAAGAGAGACTCGAGTCTCTCTTATTCTGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-311s1c1
Sequence:CCGGGTTGTTGCACTAATTTCCAAACTCGAGTTTGGAAATTAGTGCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-713s21c1
Sequence:CCGGATGGCAAGGTGCCAGGATTTGCTCGAGCAAATCCTGGCACCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-585s21c1
Sequence:CCGGTCTTGGCTGTTGCACTAATTTCTCGAGAAATTAGTGCAACAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152399.2-2111s21c1
Sequence:CCGGCACCTTCCTAGTGACTATTATCTCGAGATAATAGTCACTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-867s21c1
Sequence:CCGGGCTTCCTCAGCAGCCCAATAACTCGAGTTATTGGGCTGCTGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-927s21c1
Sequence:CCGGCTACTGCTATCTGCAAGATTGCTCGAGCAATCTTGCAGATAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152399
TMEM155 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 155
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-555s1c1
Sequence:CCGGGCATGCCAGTTCAAATCCACTCTCGAGAGTGGATTTGAACTGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-373s1c1
Sequence:CCGGGATTCTACAGAATAAGAGAGACTCGAGTCTCTCTTATTCTGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-311s1c1
Sequence:CCGGGTTGTTGCACTAATTTCCAAACTCGAGTTTGGAAATTAGTGCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-713s21c1
Sequence:CCGGATGGCAAGGTGCCAGGATTTGCTCGAGCAAATCCTGGCACCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-585s21c1
Sequence:CCGGTCTTGGCTGTTGCACTAATTTCTCGAGAAATTAGTGCAACAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152399.2-2111s21c1
Sequence:CCGGCACCTTCCTAGTGACTATTATCTCGAGATAATAGTCACTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-867s21c1
Sequence:CCGGGCTTCCTCAGCAGCCCAATAACTCGAGTTATTGGGCTGCTGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-927s21c1
Sequence:CCGGCTACTGCTATCTGCAAGATTGCTCGAGCAATCTTGCAGATAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152399
TMEM155 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 155
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-555s1c1
Sequence:CCGGGCATGCCAGTTCAAATCCACTCTCGAGAGTGGATTTGAACTGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-373s1c1
Sequence:CCGGGATTCTACAGAATAAGAGAGACTCGAGTCTCTCTTATTCTGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152399.1-311s1c1
Sequence:CCGGGTTGTTGCACTAATTTCCAAACTCGAGTTTGGAAATTAGTGCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-713s21c1
Sequence:CCGGATGGCAAGGTGCCAGGATTTGCTCGAGCAAATCCTGGCACCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-585s21c1
Sequence:CCGGTCTTGGCTGTTGCACTAATTTCTCGAGAAATTAGTGCAACAGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152399.2-2111s21c1
Sequence:CCGGCACCTTCCTAGTGACTATTATCTCGAGATAATAGTCACTAGGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-867s21c1
Sequence:CCGGGCTTCCTCAGCAGCCCAATAACTCGAGTTATTGGGCTGCTGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152399.2-927s21c1
Sequence:CCGGCTACTGCTATCTGCAAGATTGCTCGAGCAATCTTGCAGATAGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks