EMAIL THIS PAGE TO A FRIEND

TMEM156

transmembrane protein 156

UniProtKB ID: Q8N614, Q9H5N9
Gene ID:
Mouse(243025) transmembrane protein 156
Rat(498365) transmembrane protein 156
naked mole-rat(101696856) transmembrane protein 156
domestic guinea pig(100733421) transmembrane protein 156
cow(533681) transmembrane protein 156
sheep(101112482) transmembrane protein 156
chicken(426317) transmembrane protein 156
dog(611297) transmembrane protein 156
domestic cat(101094847) transmembrane protein 156
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024943 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024943 Rosetta Predictions human pricing
NM_001025138 Rosetta Predictions rat pricing
XM_144292 Rosetta Predictions mouse pricing
XM_914571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080196 predicted 680
2 SASI_Hs01_00080197 predicted 301
3 SASI_Hs01_00080198 predicted 486
4 SASI_Hs01_00080199 predicted 1015
5 SASI_Hs01_00080200 predicted 865
6 SASI_Hs02_00357588 predicted 632
7 SASI_Hs01_00080201 predicted 1016
8 SASI_Hs01_00080202 predicted 1065
9 SASI_Hs02_00357589 predicted 1059
10 SASI_Hs01_00080205 predicted 219
11 SASI_Hs01_00080203 predicted 540
12 SASI_Hs01_00080204 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052544 predicted 657
2 SASI_Rn01_00052545 predicted 279
3 SASI_Rn01_00052546 predicted 897
4 SASI_Rn01_00052547 predicted 869
5 SASI_Rn01_00052548 predicted 695
6 SASI_Rn01_00052549 predicted 347
7 SASI_Rn01_00052550 predicted 247
8 SASI_Rn02_00203065 predicted 769
9 SASI_Rn01_00052551 predicted 295
10 SASI_Rn02_00203066 predicted 463
11 SASI_Rn01_00052552 predicted 416
12 SASI_Rn01_00052553 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425235 predicted 201
2 SASI_Mm02_00425236 predicted 217
3 SASI_Mm02_00425237 predicted 249
4 SASI_Mm01_00223493 predicted 322
5 SASI_Mm02_00425238 predicted 208
6 SASI_Mm02_00425239 predicted 279
7 SASI_Mm02_00425240 predicted 258
8 SASI_Mm02_00425241 predicted 244
9 SASI_Mm01_00223495 predicted 316
10 SASI_Mm02_00425242 predicted 274
11 SASI_Mm01_00223492 predicted 270
12 SASI_Mm01_00223494 predicted 362
13 SASI_Mm01_00223496 predicted 363
14 SASI_Mm01_00223497 predicted 301
15 SASI_Mm01_00223498 predicted 355
16 SASI_Mm01_00223499 predicted 370
17 SASI_Mm01_00223500 predicted 266
18 SASI_Mm01_00223501 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438667 predicted 610
2 SASI_Mm02_00438668 predicted 216
3 SASI_Mm02_00438669 predicted 546
4 SASI_Mm02_00438670 predicted 243
5 SASI_Mm02_00438671 predicted 568
6 SASI_Mm02_00438672 predicted 377
7 SASI_Mm02_00438673 predicted 722
8 SASI_Mm02_00438674 predicted 672
9 SASI_Mm02_00438675 predicted 397
10 SASI_Mm02_00438676 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024943
TMEM156 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 156
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-298s21c1
Sequence:CCGGGTAAGGGAAACTCAGATTATCCTCGAGGATAATCTGAGTTTCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-372s21c1
Sequence:CCGGAGACATCACAGGTGAATTTAACTCGAGTTAAATTCACCTGTGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-634s21c1
Sequence:CCGGAGCAAGGAGAAATCGATAAACCTCGAGGTTTATCGATTTCTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024943.1-223s1c1
Sequence:CCGGGAAGTGTGTTTGCAATCTAATCTCGAGATTAGATTGCAAACACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024943.1-840s1c1
Sequence:CCGGGTGGCAGAGTCATAGAGACAACTCGAGTTGTCTCTATGACTCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024943
TMEM156 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 156
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-298s21c1
Sequence:CCGGGTAAGGGAAACTCAGATTATCCTCGAGGATAATCTGAGTTTCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-372s21c1
Sequence:CCGGAGACATCACAGGTGAATTTAACTCGAGTTAAATTCACCTGTGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-634s21c1
Sequence:CCGGAGCAAGGAGAAATCGATAAACCTCGAGGTTTATCGATTTCTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024943.1-223s1c1
Sequence:CCGGGAAGTGTGTTTGCAATCTAATCTCGAGATTAGATTGCAAACACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024943.1-840s1c1
Sequence:CCGGGTGGCAGAGTCATAGAGACAACTCGAGTTGTCTCTATGACTCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024943
TMEM156 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 156
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-298s21c1
Sequence:CCGGGTAAGGGAAACTCAGATTATCCTCGAGGATAATCTGAGTTTCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-372s21c1
Sequence:CCGGAGACATCACAGGTGAATTTAACTCGAGTTAAATTCACCTGTGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024943.1-634s21c1
Sequence:CCGGAGCAAGGAGAAATCGATAAACCTCGAGGTTTATCGATTTCTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024943.1-223s1c1
Sequence:CCGGGAAGTGTGTTTGCAATCTAATCTCGAGATTAGATTGCAAACACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024943.1-840s1c1
Sequence:CCGGGTGGCAGAGTCATAGAGACAACTCGAGTTGTCTCTATGACTCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks