EMAIL THIS PAGE TO A FRIEND

TMEM158

transmembrane protein 158 (gene/pseudogene)

Synonyms: BBP RIS1 p40BBP
UniProtKB ID: Q8WZ71, Q6PFW5, Q9Y4M1
Gene ID:
Human(25907) Summary: Constitutive activation of the Ras pathway triggers an irreversible proliferation arrest reminiscent of replicative senescence. Transcription of this gene is upregulated in response to activation of the Ras pathway, but not under other conditions that induce senescence. The encoded protein is similar to a rat cell surface receptor proposed to function in a neuronal survival pathway. [provided by RefSeq, Jul 2008]
Mouse(72309) transmembrane protein 158
Rat(117582) transmembrane protein 158
chicken(776186) transmembrane protein 158
cow(788085) transmembrane protein 158
domestic guinea pig(100716946) transmembrane protein 158
naked mole-rat(101700444) transmembrane protein 158
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105037 Anti-TMEM158 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015444 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001002267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221591 MISSION® esiRNA esiRNA targeting human TMEM158 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015444 Rosetta Predictions human pricing
NM_057212 Rosetta Predictions rat pricing
NM_001002267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109918 predicted 586
2 SASI_Hs02_00347832 predicted 935
3 SASI_Hs01_00109924 predicted 931
4 SASI_Hs02_00347833 predicted 875
5 SASI_Hs02_00347834 predicted 1290
6 SASI_Hs01_00109919 predicted 1343
7 SASI_Hs01_00109920 predicted 1266
8 SASI_Hs01_00109921 predicted 1614
9 SASI_Hs01_00109922 predicted 1348
10 SASI_Hs01_00109923 predicted 1637
11 SASI_Hs01_00109925 predicted 458
12 SASI_Hs01_00109926 predicted 1215
13 SASI_Hs01_00109927 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267170 predicted 718
2 SASI_Rn01_00107935 predicted 539
3 SASI_Rn01_00107936 predicted 326
4 SASI_Rn01_00107940 predicted 652
5 SASI_Rn02_00267171 predicted 350
6 SASI_Rn01_00107941 predicted 490
7 SASI_Rn01_00107942 predicted 714
8 SASI_Rn02_00267172 predicted 330
9 SASI_Rn01_00107943 predicted 443
10 SASI_Rn01_00107944 predicted 531
11 SASI_Rn01_00107937 predicted 490
12 SASI_Rn01_00107938 predicted 645
13 SASI_Rn01_00107939 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133903 predicted 439
2 SASI_Mm01_00133904 predicted 764
3 SASI_Mm01_00133906 predicted 648
4 SASI_Mm01_00133907 predicted 635
5 SASI_Mm01_00133908 predicted 599
6 SASI_Mm02_00286285 predicted 356
7 SASI_Mm01_00133909 predicted 582
8 SASI_Mm01_00133910 predicted 548
9 SASI_Mm02_00286286 predicted 356
10 SASI_Mm02_00286287 predicted 440
11 SASI_Mm01_00133905 predicted 352
12 SASI_Mm01_00133911 predicted 534
13 SASI_Mm01_00133912 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015444
VALIDATED
TMEM158 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 158 (gene/pseudogene)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-988s1c1
Sequence:CCGGCCTGCCCAACGGCATGGAACACTCGAGTGTTCCATGCCGTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-472s1c1
Sequence:CCGGGCGGCAGATGCTGAGCTCGCTCTCGAGAGCGAGCTCAGCATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-532s1c1
Sequence:CCGGCCTACTGCTCTTCTCCACCAACTCGAGTTGGTGGAGAAGAGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-874s1c1
Sequence:CCGGGCGGCTGAACCGTAAGCCCATCTCGAGATGGGCTTACGGTTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-820s1c1
Sequence:CCGGGCATTTCTGCTGCCTAGACTTCTCGAGAAGTCTAGGCAGCAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-532s21c1
Sequence:CCGGGCGGCAGATGCTGAGCTCGCTCTCGAGAGCGAGCTCAGCATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-1048s21c1
Sequence:CCGGCCTGCCCAACGGCATGGAACACTCGAGTGTTCCATGCCGTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-934s21c1
Sequence:CCGGGCGGCTGAACCGTAAGCCCATCTCGAGATGGGCTTACGGTTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-592s21c1
Sequence:CCGGCCTACTGCTCTTCTCCACCAACTCGAGTTGGTGGAGAAGAGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-880s21c1
Sequence:CCGGGCATTTCTGCTGCCTAGACTTCTCGAGAAGTCTAGGCAGCAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015444
VALIDATED
TMEM158 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 158 (gene/pseudogene)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-988s1c1
Sequence:CCGGCCTGCCCAACGGCATGGAACACTCGAGTGTTCCATGCCGTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-472s1c1
Sequence:CCGGGCGGCAGATGCTGAGCTCGCTCTCGAGAGCGAGCTCAGCATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-532s1c1
Sequence:CCGGCCTACTGCTCTTCTCCACCAACTCGAGTTGGTGGAGAAGAGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-874s1c1
Sequence:CCGGGCGGCTGAACCGTAAGCCCATCTCGAGATGGGCTTACGGTTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-820s1c1
Sequence:CCGGGCATTTCTGCTGCCTAGACTTCTCGAGAAGTCTAGGCAGCAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-532s21c1
Sequence:CCGGGCGGCAGATGCTGAGCTCGCTCTCGAGAGCGAGCTCAGCATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-1048s21c1
Sequence:CCGGCCTGCCCAACGGCATGGAACACTCGAGTGTTCCATGCCGTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-934s21c1
Sequence:CCGGGCGGCTGAACCGTAAGCCCATCTCGAGATGGGCTTACGGTTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-592s21c1
Sequence:CCGGCCTACTGCTCTTCTCCACCAACTCGAGTTGGTGGAGAAGAGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-880s21c1
Sequence:CCGGGCATTTCTGCTGCCTAGACTTCTCGAGAAGTCTAGGCAGCAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015444
VALIDATED
TMEM158 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 158 (gene/pseudogene)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-988s1c1
Sequence:CCGGCCTGCCCAACGGCATGGAACACTCGAGTGTTCCATGCCGTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-472s1c1
Sequence:CCGGGCGGCAGATGCTGAGCTCGCTCTCGAGAGCGAGCTCAGCATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-532s1c1
Sequence:CCGGCCTACTGCTCTTCTCCACCAACTCGAGTTGGTGGAGAAGAGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-874s1c1
Sequence:CCGGGCGGCTGAACCGTAAGCCCATCTCGAGATGGGCTTACGGTTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015444.1-820s1c1
Sequence:CCGGGCATTTCTGCTGCCTAGACTTCTCGAGAAGTCTAGGCAGCAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-532s21c1
Sequence:CCGGGCGGCAGATGCTGAGCTCGCTCTCGAGAGCGAGCTCAGCATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-1048s21c1
Sequence:CCGGCCTGCCCAACGGCATGGAACACTCGAGTGTTCCATGCCGTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-934s21c1
Sequence:CCGGGCGGCTGAACCGTAAGCCCATCTCGAGATGGGCTTACGGTTCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-592s21c1
Sequence:CCGGCCTACTGCTCTTCTCCACCAACTCGAGTTGGTGGAGAAGAGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015444.2-880s21c1
Sequence:CCGGGCATTTCTGCTGCCTAGACTTCTCGAGAAGTCTAGGCAGCAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002267
VALIDATED
TMEM158 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 158 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-358s21c1
Sequence:CCGGTGCGTCCTTCACCAACGAACACTCGAGTGTTCGTTGGTGAAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002267.2-604s21c1
Sequence:CCGGACCACTGCTCATCGAGCATCTCTCGAGAGATGCTCGATGAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-1374s21c1
Sequence:CCGGTGCGCCCACATGCCCTTTATTCTCGAGAATAAAGGGCATGTGGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-463s21c1
Sequence:CCGGCATCAGCGTGCAACGACAGATCTCGAGATCTGTCGTTGCACGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-536s21c1
Sequence:CCGGCTGCTGCTCTTCTCTACCAACCTCGAGGTTGGTAGAGAAGAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002267
VALIDATED
TMEM158 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 158 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-358s21c1
Sequence:CCGGTGCGTCCTTCACCAACGAACACTCGAGTGTTCGTTGGTGAAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002267.2-604s21c1
Sequence:CCGGACCACTGCTCATCGAGCATCTCTCGAGAGATGCTCGATGAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-1374s21c1
Sequence:CCGGTGCGCCCACATGCCCTTTATTCTCGAGAATAAAGGGCATGTGGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-463s21c1
Sequence:CCGGCATCAGCGTGCAACGACAGATCTCGAGATCTGTCGTTGCACGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-536s21c1
Sequence:CCGGCTGCTGCTCTTCTCTACCAACCTCGAGGTTGGTAGAGAAGAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002267
VALIDATED
TMEM158 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 158 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-358s21c1
Sequence:CCGGTGCGTCCTTCACCAACGAACACTCGAGTGTTCGTTGGTGAAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002267.2-604s21c1
Sequence:CCGGACCACTGCTCATCGAGCATCTCTCGAGAGATGCTCGATGAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-1374s21c1
Sequence:CCGGTGCGCCCACATGCCCTTTATTCTCGAGAATAAAGGGCATGTGGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-463s21c1
Sequence:CCGGCATCAGCGTGCAACGACAGATCTCGAGATCTGTCGTTGCACGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001002267.2-536s21c1
Sequence:CCGGCTGCTGCTCTTCTCTACCAACCTCGAGGTTGGTAGAGAAGAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks