EMAIL THIS PAGE TO A FRIEND

TMEM159

transmembrane protein 159

Synonyms: PROMETHIN
UniProtKB ID: Q96B96, A6NMA9, O00323
Gene ID:
Mouse(233806) transmembrane protein 159
Rat(378467) transmembrane protein 159
naked mole-rat(101705325) transmembrane protein 159
domestic guinea pig(100713233) transmembrane protein 159
cow(784639) transmembrane protein 159
sheep(101123004) transmembrane protein 159
chicken(427005) transmembrane protein 159
domestic cat(101081270) transmembrane protein 159
dog(479819) transmembrane protein 159
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020422 Rosetta Predictions human pricing
NM_194354 Rosetta Predictions rat pricing
NM_145586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353423 predicted 424
2 SASI_Hs01_00229185 predicted 759
3 SASI_Hs01_00229194 predicted 340
4 SASI_Hs02_00353424 predicted 522
5 SASI_Hs02_00353425 predicted 328
6 SASI_Hs01_00229186 predicted 932
7 SASI_Hs01_00229187 predicted 525
8 SASI_Hs02_00353426 predicted 698
9 SASI_Hs02_00353427 predicted 712
10 SASI_Hs02_00353428 predicted 480
11 SASI_Hs01_00229188 predicted 562
12 SASI_Hs01_00229189 predicted 616
13 SASI_Hs01_00229190 predicted 817
14 SASI_Hs01_00229191 predicted 394
15 SASI_Hs01_00229192 predicted 553
16 SASI_Hs01_00229193 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071599 predicted 879
2 SASI_Rn02_00269908 predicted 938
3 SASI_Rn01_00071600 predicted 515
4 SASI_Rn01_00071601 predicted 853
5 SASI_Rn01_00071602 predicted 880
6 SASI_Rn01_00071603 predicted 510
7 SASI_Rn01_00071604 predicted 231
8 SASI_Rn02_00269909 predicted 667
9 SASI_Rn01_00071605 predicted 895
10 SASI_Rn01_00071606 predicted 852
11 SASI_Rn01_00071598 predicted 452
12 SASI_Rn01_00071607 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059050 predicted 209
2 SASI_Mm01_00059051 predicted 263
3 SASI_Mm01_00059052 predicted 562
4 SASI_Mm01_00059053 predicted 344
5 SASI_Mm01_00059054 predicted 650
6 SASI_Mm01_00059055 predicted 348
7 SASI_Mm01_00059056 predicted 213
8 SASI_Mm01_00059057 predicted 262
9 SASI_Mm01_00059058 predicted 640
10 SASI_Mm01_00059059 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020422
TMEM159 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 159
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020422.4-492s21c1
Sequence:CCGGACTTGGACAGCCATCCGTTTCCTCGAGGAAACGGATGGCTGTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020422.3-342s1c1
Sequence:CCGGGATAGACTCCTTCCAGAATAACTCGAGTTATTCTGGAAGGAGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-339s1c1
Sequence:CCGGGCTGATAGACTCCTTCCAGAACTCGAGTTCTGGAAGGAGTCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020422.3-958s1c1
Sequence:CCGGCAGCAGAGAAATGCGATGGTTCTCGAGAACCATCGCATTTCTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020422.3-903s1c1
Sequence:CCGGGCAGCAGCCAATTTAGGGATTCTCGAGAATCCCTAAATTGGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-624s1c1
Sequence:CCGGGATAGCATCTTATGTAGTGGTCTCGAGACCACTACATAAGATGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-365s1c1
Sequence:CCGGCAAAGGTGGTGGCCTTTATGACTCGAGTCATAAAGGCCACCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020422
TMEM159 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 159
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020422.4-492s21c1
Sequence:CCGGACTTGGACAGCCATCCGTTTCCTCGAGGAAACGGATGGCTGTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020422.3-342s1c1
Sequence:CCGGGATAGACTCCTTCCAGAATAACTCGAGTTATTCTGGAAGGAGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-339s1c1
Sequence:CCGGGCTGATAGACTCCTTCCAGAACTCGAGTTCTGGAAGGAGTCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020422.3-958s1c1
Sequence:CCGGCAGCAGAGAAATGCGATGGTTCTCGAGAACCATCGCATTTCTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020422.3-903s1c1
Sequence:CCGGGCAGCAGCCAATTTAGGGATTCTCGAGAATCCCTAAATTGGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-624s1c1
Sequence:CCGGGATAGCATCTTATGTAGTGGTCTCGAGACCACTACATAAGATGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-365s1c1
Sequence:CCGGCAAAGGTGGTGGCCTTTATGACTCGAGTCATAAAGGCCACCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020422
TMEM159 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 159
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020422.4-492s21c1
Sequence:CCGGACTTGGACAGCCATCCGTTTCCTCGAGGAAACGGATGGCTGTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020422.3-342s1c1
Sequence:CCGGGATAGACTCCTTCCAGAATAACTCGAGTTATTCTGGAAGGAGTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-339s1c1
Sequence:CCGGGCTGATAGACTCCTTCCAGAACTCGAGTTCTGGAAGGAGTCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020422.3-958s1c1
Sequence:CCGGCAGCAGAGAAATGCGATGGTTCTCGAGAACCATCGCATTTCTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020422.3-903s1c1
Sequence:CCGGGCAGCAGCCAATTTAGGGATTCTCGAGAATCCCTAAATTGGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-624s1c1
Sequence:CCGGGATAGCATCTTATGTAGTGGTCTCGAGACCACTACATAAGATGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020422.3-365s1c1
Sequence:CCGGCAAAGGTGGTGGCCTTTATGACTCGAGTCATAAAGGCCACCACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145586
VALIDATED
TMEM159 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 159
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-657s21c1
Sequence:CCGGGAGTCTGAGAGGCTCATATTTCTCGAGAAATATGAGCCTCTCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-263s21c1
Sequence:CCGGGTTAGAGTCTTTCCTGAATAACTCGAGTTATTCAGGAAAGACTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-964s21c1
Sequence:CCGGGCGGCTAAGATAGATTGTATTCTCGAGAATACAATCTATCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-349s21c1
Sequence:CCGGCTCTCACCGTGCTGATGTTTGCTCGAGCAAACATCAGCACGGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145586.1-540s21c1
Sequence:CCGGATAGCCATGATGTCCTATGTGCTCGAGCACATAGGACATCATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-323s1c1
Sequence:CCGGGTTCCTGGACAGACATCCTTTCTCGAGAAAGGATGTCTGTCCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-642s1c1
Sequence:CCGGGCTATGAAGTTCACGGAGTCTCTCGAGAGACTCCGTGAACTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-263s1c1
Sequence:CCGGGTTAGAGTCTTTCCTGAATAACTCGAGTTATTCAGGAAAGACTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145586.1-356s1c1
Sequence:CCGGCGTGCTGATGTTTGTTACCATCTCGAGATGGTAACAAACATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-964s1c1
Sequence:CCGGGCGGCTAAGATAGATTGTATTCTCGAGAATACAATCTATCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145586
VALIDATED
TMEM159 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 159
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-657s21c1
Sequence:CCGGGAGTCTGAGAGGCTCATATTTCTCGAGAAATATGAGCCTCTCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-263s21c1
Sequence:CCGGGTTAGAGTCTTTCCTGAATAACTCGAGTTATTCAGGAAAGACTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-964s21c1
Sequence:CCGGGCGGCTAAGATAGATTGTATTCTCGAGAATACAATCTATCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-349s21c1
Sequence:CCGGCTCTCACCGTGCTGATGTTTGCTCGAGCAAACATCAGCACGGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145586.1-540s21c1
Sequence:CCGGATAGCCATGATGTCCTATGTGCTCGAGCACATAGGACATCATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-323s1c1
Sequence:CCGGGTTCCTGGACAGACATCCTTTCTCGAGAAAGGATGTCTGTCCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-642s1c1
Sequence:CCGGGCTATGAAGTTCACGGAGTCTCTCGAGAGACTCCGTGAACTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-263s1c1
Sequence:CCGGGTTAGAGTCTTTCCTGAATAACTCGAGTTATTCAGGAAAGACTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145586.1-356s1c1
Sequence:CCGGCGTGCTGATGTTTGTTACCATCTCGAGATGGTAACAAACATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-964s1c1
Sequence:CCGGGCGGCTAAGATAGATTGTATTCTCGAGAATACAATCTATCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145586
VALIDATED
TMEM159 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 159
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-657s21c1
Sequence:CCGGGAGTCTGAGAGGCTCATATTTCTCGAGAAATATGAGCCTCTCAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-263s21c1
Sequence:CCGGGTTAGAGTCTTTCCTGAATAACTCGAGTTATTCAGGAAAGACTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-964s21c1
Sequence:CCGGGCGGCTAAGATAGATTGTATTCTCGAGAATACAATCTATCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145586.1-349s21c1
Sequence:CCGGCTCTCACCGTGCTGATGTTTGCTCGAGCAAACATCAGCACGGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145586.1-540s21c1
Sequence:CCGGATAGCCATGATGTCCTATGTGCTCGAGCACATAGGACATCATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-323s1c1
Sequence:CCGGGTTCCTGGACAGACATCCTTTCTCGAGAAAGGATGTCTGTCCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-642s1c1
Sequence:CCGGGCTATGAAGTTCACGGAGTCTCTCGAGAGACTCCGTGAACTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-263s1c1
Sequence:CCGGGTTAGAGTCTTTCCTGAATAACTCGAGTTATTCAGGAAAGACTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145586.1-356s1c1
Sequence:CCGGCGTGCTGATGTTTGTTACCATCTCGAGATGGTAACAAACATCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145586.1-964s1c1
Sequence:CCGGGCGGCTAAGATAGATTGTATTCTCGAGAATACAATCTATCTTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks