EMAIL THIS PAGE TO A FRIEND

TMEM160

transmembrane protein 160

UniProtKB ID: Q9NX00, Q9BU41
Gene ID:
Mouse(69094) transmembrane protein 160
Rat(292654) transmembrane protein 160
Zebrafish(559491) transmembrane protein 160
domestic cat(101089663) transmembrane protein 160
dog(476426) transmembrane protein 160
cow(508953) transmembrane protein 160
sheep(101122974) transmembrane protein 160
domestic guinea pig(100727369) transmembrane protein 160
naked mole-rat(101718431) transmembrane protein 160
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017854 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017854 Rosetta Predictions human pricing
NM_001106227 Rosetta Predictions rat pricing
NM_026938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024024 predicted 610
2 SASI_Hs01_00024025 predicted 458
3 SASI_Hs01_00024026 predicted 175
4 SASI_Hs01_00024028 predicted 555
5 SASI_Hs02_00350751 predicted 609
6 SASI_Hs01_00024029 predicted 230
7 SASI_Hs02_00350752 predicted 528
8 SASI_Hs01_00024030 predicted 37
9 SASI_Hs01_00024031 predicted 517
10 SASI_Hs01_00024032 predicted 29
11 SASI_Hs01_00024027 predicted 220
12 SASI_Hs01_00024033 predicted 53
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216888 predicted 431
2 SASI_Rn02_00216889 predicted 533
3 SASI_Rn02_00216890 predicted 213
4 SASI_Rn02_00216891 predicted 362
5 SASI_Rn02_00216892 predicted 295
6 SASI_Rn02_00216893 predicted 358
7 SASI_Rn02_00216894 predicted 439
8 SASI_Rn02_00216895 predicted 524
9 SASI_Rn02_00216896 predicted 405
10 SASI_Rn02_00216897 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118747 predicted 414
2 SASI_Mm01_00118748 predicted 466
3 SASI_Mm01_00118749 predicted 375
4 SASI_Mm02_00331233 predicted 471
5 SASI_Mm01_00118750 predicted 327
6 SASI_Mm02_00331234 predicted 316
7 SASI_Mm01_00118751 predicted 362
8 SASI_Mm01_00118752 predicted 209
9 SASI_Mm01_00118753 predicted 436
10 SASI_Mm01_00118754 predicted 529
11 SASI_Mm01_00118755 predicted 374
12 SASI_Mm01_00118756 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026938
VALIDATED
TMEM160 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 160
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-563s1c1
Sequence:CCGGCCCATGCAACTGTCGCTTGCTCTCGAGAGCAAGCGACAGTTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026938.1-408s1c1
Sequence:CCGGTCCGAAATGGACTTCTGTCATCTCGAGATGACAGAAGTCCATTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026938.1-659s1c1
Sequence:CCGGCAGTTGGAACTGGACGTGGAACTCGAGTTCCACGTCCAGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-375s1c1
Sequence:CCGGGCAAGGCACATGAGACAGCTTCTCGAGAAGCTGTCTCATGTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-633s1c1
Sequence:CCGGCTTGTGCAGTAGGTCTCTACACTCGAGTGTAGAGACCTACTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-408s21c1
Sequence:CCGGTCCGAAATGGACTTCTGTCATCTCGAGATGACAGAAGTCCATTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-563s21c1
Sequence:CCGGCCCATGCAACTGTCGCTTGCTCTCGAGAGCAAGCGACAGTTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-375s21c1
Sequence:CCGGGCAAGGCACATGAGACAGCTTCTCGAGAAGCTGTCTCATGTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-633s21c1
Sequence:CCGGCTTGTGCAGTAGGTCTCTACACTCGAGTGTAGAGACCTACTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-659s21c1
Sequence:CCGGCAGTTGGAACTGGACGTGGAACTCGAGTTCCACGTCCAGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026938
VALIDATED
TMEM160 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 160
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-563s1c1
Sequence:CCGGCCCATGCAACTGTCGCTTGCTCTCGAGAGCAAGCGACAGTTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026938.1-408s1c1
Sequence:CCGGTCCGAAATGGACTTCTGTCATCTCGAGATGACAGAAGTCCATTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026938.1-659s1c1
Sequence:CCGGCAGTTGGAACTGGACGTGGAACTCGAGTTCCACGTCCAGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-375s1c1
Sequence:CCGGGCAAGGCACATGAGACAGCTTCTCGAGAAGCTGTCTCATGTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-633s1c1
Sequence:CCGGCTTGTGCAGTAGGTCTCTACACTCGAGTGTAGAGACCTACTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-408s21c1
Sequence:CCGGTCCGAAATGGACTTCTGTCATCTCGAGATGACAGAAGTCCATTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-563s21c1
Sequence:CCGGCCCATGCAACTGTCGCTTGCTCTCGAGAGCAAGCGACAGTTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-375s21c1
Sequence:CCGGGCAAGGCACATGAGACAGCTTCTCGAGAAGCTGTCTCATGTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-633s21c1
Sequence:CCGGCTTGTGCAGTAGGTCTCTACACTCGAGTGTAGAGACCTACTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-659s21c1
Sequence:CCGGCAGTTGGAACTGGACGTGGAACTCGAGTTCCACGTCCAGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026938
VALIDATED
TMEM160 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 160
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-563s1c1
Sequence:CCGGCCCATGCAACTGTCGCTTGCTCTCGAGAGCAAGCGACAGTTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026938.1-408s1c1
Sequence:CCGGTCCGAAATGGACTTCTGTCATCTCGAGATGACAGAAGTCCATTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026938.1-659s1c1
Sequence:CCGGCAGTTGGAACTGGACGTGGAACTCGAGTTCCACGTCCAGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-375s1c1
Sequence:CCGGGCAAGGCACATGAGACAGCTTCTCGAGAAGCTGTCTCATGTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026938.1-633s1c1
Sequence:CCGGCTTGTGCAGTAGGTCTCTACACTCGAGTGTAGAGACCTACTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-408s21c1
Sequence:CCGGTCCGAAATGGACTTCTGTCATCTCGAGATGACAGAAGTCCATTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-563s21c1
Sequence:CCGGCCCATGCAACTGTCGCTTGCTCTCGAGAGCAAGCGACAGTTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-375s21c1
Sequence:CCGGGCAAGGCACATGAGACAGCTTCTCGAGAAGCTGTCTCATGTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-633s21c1
Sequence:CCGGCTTGTGCAGTAGGTCTCTACACTCGAGTGTAGAGACCTACTGCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026938.1-659s21c1
Sequence:CCGGCAGTTGGAACTGGACGTGGAACTCGAGTTCCACGTCCAGTTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017854
VALIDATED
TMEM160 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 160
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-221s21c1
Sequence:CCGGTTCCTCTCCTGGTTCCGCAATCTCGAGATTGCGGAACCAGGAGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-276s21c1
Sequence:CCGGTCATGCAGAGTGACATGGGTCCTCGAGGACCCATGTCACTCTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017854.1-307s21c1
Sequence:CCGGATATGGCTTCTTCCTGCTGGGCTCGAGCCCAGCAGGAAGAAGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-290s21c1
Sequence:CCGGATGGGTCGGGAAGCAGCATATCTCGAGATATGCTGCTTCCCGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-264s21c1
Sequence:CCGGGGGTCATCTCCTTCATGCAGACTCGAGTCTGCATGAAGGAGATGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017854
VALIDATED
TMEM160 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 160
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-221s21c1
Sequence:CCGGTTCCTCTCCTGGTTCCGCAATCTCGAGATTGCGGAACCAGGAGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-276s21c1
Sequence:CCGGTCATGCAGAGTGACATGGGTCCTCGAGGACCCATGTCACTCTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017854.1-307s21c1
Sequence:CCGGATATGGCTTCTTCCTGCTGGGCTCGAGCCCAGCAGGAAGAAGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-290s21c1
Sequence:CCGGATGGGTCGGGAAGCAGCATATCTCGAGATATGCTGCTTCCCGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-264s21c1
Sequence:CCGGGGGTCATCTCCTTCATGCAGACTCGAGTCTGCATGAAGGAGATGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017854
VALIDATED
TMEM160 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 160
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-221s21c1
Sequence:CCGGTTCCTCTCCTGGTTCCGCAATCTCGAGATTGCGGAACCAGGAGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-276s21c1
Sequence:CCGGTCATGCAGAGTGACATGGGTCCTCGAGGACCCATGTCACTCTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017854.1-307s21c1
Sequence:CCGGATATGGCTTCTTCCTGCTGGGCTCGAGCCCAGCAGGAAGAAGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-290s21c1
Sequence:CCGGATGGGTCGGGAAGCAGCATATCTCGAGATATGCTGCTTCCCGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017854.1-264s21c1
Sequence:CCGGGGGTCATCTCCTTCATGCAGACTCGAGTCTGCATGAAGGAGATGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks