EMAIL THIS PAGE TO A FRIEND

TMEM161A

transmembrane protein 161A

Synonyms: AROS-29
UniProtKB ID: Q9NX61, B3KUE0, G5E9M6, Q7L2Y1
Gene ID:
Mouse(234371) transmembrane protein 161A
Rat(364535) transmembrane protein 161A
naked mole-rat(101711326) transmembrane protein 161A
domestic guinea pig(100720859) transmembrane protein 161A
cow(618720) transmembrane protein 161A
sheep(101106325) transmembrane protein 161A
Zebrafish(492692) transmembrane protein 161A
dog(484810) transmembrane protein 161A
Horse(100071121) transmembrane protein 161A
chicken(100857264) transmembrane protein 161A
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017814 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017814 Rosetta Predictions human pricing
NM_001108874 Rosetta Predictions rat pricing
NM_145597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110779 predicted 490
2 SASI_Hs01_00110780 predicted 455
3 SASI_Hs01_00110782 predicted 219
4 SASI_Hs01_00110783 predicted 632
5 SASI_Hs01_00110785 predicted 928
6 SASI_Hs01_00110786 predicted 486
7 SASI_Hs01_00110787 predicted 1083
8 SASI_Hs01_00110788 predicted 1177
9 SASI_Hs02_00350678 predicted 476
10 SASI_Hs02_00350679 predicted 447
11 SASI_Hs01_00110781 predicted 461
12 SASI_Hs01_00110784 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242935 predicted 338
2 SASI_Rn02_00242936 predicted 1565
3 SASI_Rn02_00242937 predicted 1108
4 SASI_Rn02_00242938 predicted 1498
5 SASI_Rn02_00242939 predicted 1353
6 SASI_Rn02_00242940 predicted 1252
7 SASI_Rn02_00242941 predicted 353
8 SASI_Rn02_00242942 predicted 201
9 SASI_Rn02_00242943 predicted 451
10 SASI_Rn02_00242944 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020206 predicted 1509
2 SASI_Mm01_00020207 predicted 917
3 SASI_Mm01_00020208 predicted 352
4 SASI_Mm01_00020209 predicted 213
5 SASI_Mm01_00020210 predicted 1119
6 SASI_Mm01_00020211 predicted 367
7 SASI_Mm01_00020212 predicted 309
8 SASI_Mm01_00020213 predicted 1457
9 SASI_Mm01_00020214 predicted 1084
10 SASI_Mm02_00341138 predicted 1372
11 SASI_Mm01_00020215 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017814
TMEM161A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 161A
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000432601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017814.1-642s21c1
Sequence:CCGGCCAGAACTTAGAGCCACTTCTCTCGAGAGAAGTGGCTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017814.1-949s21c1
Sequence:CCGGTCCGATTCTGCCTTCGACTCTCTCGAGAGAGTCGAAGGCAGAATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017814
TMEM161A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 161A
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000432601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017814.1-642s21c1
Sequence:CCGGCCAGAACTTAGAGCCACTTCTCTCGAGAGAAGTGGCTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017814.1-949s21c1
Sequence:CCGGTCCGATTCTGCCTTCGACTCTCTCGAGAGAGTCGAAGGCAGAATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017814
TMEM161A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 161A
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000432601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017814.1-642s21c1
Sequence:CCGGCCAGAACTTAGAGCCACTTCTCTCGAGAGAAGTGGCTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017814.1-949s21c1
Sequence:CCGGTCCGATTCTGCCTTCGACTCTCTCGAGAGAGTCGAAGGCAGAATCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145597
VALIDATED
TMEM161A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 161A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-344s21c1
Sequence:CCGGGTTCGTCGACTTCGCAGTGTACTCGAGTACACTGCGAAGTCGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145597.2-2506s21c1
Sequence:CCGGTGTAGGAGTGCTAGGATTATACTCGAGTATAATCCTAGCACTCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-382s21c1
Sequence:CCGGTCTTCACAGAGGCCTACTATTCTCGAGAATAGTAGGCCTCTGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-1428s21c1
Sequence:CCGGAGCCTCTTCGGCCTCTATTTCCTCGAGGAAATAGAGGCCGAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-133s21c1
Sequence:CCGGGCAGTCTGTTCCGGTACATACCTCGAGGTATGTACCGGAACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145597.2-654s1c1
Sequence:CCGGCCTATTCTGAAGAAGCAGGATCTCGAGATCCTGCTTCTTCAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145597.2-533s1c1
Sequence:CCGGCGTATGTCTCTCCTTTGCCTTCTCGAGAAGGCAAAGGAGAGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145597.2-1593s1c1
Sequence:CCGGCTCTCACTTCAGTGCCTAGATCTCGAGATCTAGGCACTGAAGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145597
VALIDATED
TMEM161A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 161A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-344s21c1
Sequence:CCGGGTTCGTCGACTTCGCAGTGTACTCGAGTACACTGCGAAGTCGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145597.2-2506s21c1
Sequence:CCGGTGTAGGAGTGCTAGGATTATACTCGAGTATAATCCTAGCACTCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-382s21c1
Sequence:CCGGTCTTCACAGAGGCCTACTATTCTCGAGAATAGTAGGCCTCTGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-1428s21c1
Sequence:CCGGAGCCTCTTCGGCCTCTATTTCCTCGAGGAAATAGAGGCCGAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-133s21c1
Sequence:CCGGGCAGTCTGTTCCGGTACATACCTCGAGGTATGTACCGGAACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145597.2-654s1c1
Sequence:CCGGCCTATTCTGAAGAAGCAGGATCTCGAGATCCTGCTTCTTCAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145597.2-533s1c1
Sequence:CCGGCGTATGTCTCTCCTTTGCCTTCTCGAGAAGGCAAAGGAGAGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145597.2-1593s1c1
Sequence:CCGGCTCTCACTTCAGTGCCTAGATCTCGAGATCTAGGCACTGAAGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145597
VALIDATED
TMEM161A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 161A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-344s21c1
Sequence:CCGGGTTCGTCGACTTCGCAGTGTACTCGAGTACACTGCGAAGTCGACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145597.2-2506s21c1
Sequence:CCGGTGTAGGAGTGCTAGGATTATACTCGAGTATAATCCTAGCACTCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-382s21c1
Sequence:CCGGTCTTCACAGAGGCCTACTATTCTCGAGAATAGTAGGCCTCTGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-1428s21c1
Sequence:CCGGAGCCTCTTCGGCCTCTATTTCCTCGAGGAAATAGAGGCCGAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145597.2-133s21c1
Sequence:CCGGGCAGTCTGTTCCGGTACATACCTCGAGGTATGTACCGGAACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145597.2-654s1c1
Sequence:CCGGCCTATTCTGAAGAAGCAGGATCTCGAGATCCTGCTTCTTCAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145597.2-533s1c1
Sequence:CCGGCGTATGTCTCTCCTTTGCCTTCTCGAGAAGGCAAAGGAGAGACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145597.2-1593s1c1
Sequence:CCGGCTCTCACTTCAGTGCCTAGATCTCGAGATCTAGGCACTGAAGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks