EMAIL THIS PAGE TO A FRIEND

TMEM161B

transmembrane protein 161B

Synonyms: FLB3342 PRO1313
UniProtKB ID: Q8NDZ6, Q5CZH7, Q6UWQ6
Gene ID:
Mouse(72745) transmembrane protein 161B
Rat(309953) transmembrane protein 161B
Zebrafish(406680) transmembrane protein 161B
domestic cat(101095637) transmembrane protein 161B
Horse(100073241) transmembrane protein 161B
dog(488916) transmembrane protein 161B
chicken(426919) transmembrane protein 161B
cow(510378) transmembrane protein 161B
sheep(101105569) transmembrane protein 161B
domestic guinea pig(100725618) transmembrane protein 161B
naked mole-rat(101714810) transmembrane protein 161B
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153354 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153354 Rosetta Predictions human pricing
XM_001057417 Rosetta Predictions rat pricing
XM_226652 Rosetta Predictions rat pricing
NM_175187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086540 predicted 1368
2 SASI_Hs01_00086542 predicted 1259
3 SASI_Hs01_00086543 predicted 1109
4 SASI_Hs02_00367215 predicted 229
5 SASI_Hs02_00367216 predicted 1090
6 SASI_Hs01_00086545 predicted 983
7 SASI_Hs01_00086547 predicted 328
8 SASI_Hs02_00367217 predicted 324
9 SASI_Hs01_00086548 predicted 1338
10 SASI_Hs02_00367218 predicted 250
11 SASI_Hs01_00086541 predicted 1027
12 SASI_Hs01_00086544 predicted 246
13 SASI_Hs01_00086546 predicted 350
14 SASI_Hs01_00086549 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286257 predicted 1675
2 SASI_Rn02_00286258 predicted 244
3 SASI_Rn02_00286259 predicted 980
4 SASI_Rn02_00286260 predicted 1082
5 SASI_Rn02_00286261 predicted 1460
6 SASI_Rn02_00286262 predicted 1228
7 SASI_Rn02_00286263 predicted 1627
8 SASI_Rn02_00286264 predicted 1111
9 SASI_Rn02_00286265 predicted 926
10 SASI_Rn02_00286266 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383775 predicted 1674
2 SASI_Rn02_00383776 predicted 246
3 SASI_Rn02_00383777 predicted 984
4 SASI_Rn02_00383778 predicted 1083
5 SASI_Rn02_00383779 predicted 1463
6 SASI_Rn02_00383780 predicted 1236
7 SASI_Rn02_00383781 predicted 1628
8 SASI_Rn02_00383782 predicted 1111
9 SASI_Rn02_00383783 predicted 919
10 SASI_Rn02_00383784 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040782 predicted 339
2 SASI_Mm01_00040784 predicted 958
3 SASI_Mm01_00040785 predicted 1235
4 SASI_Mm01_00040786 predicted 1034
5 SASI_Mm01_00040787 predicted 1377
6 SASI_Mm01_00040788 predicted 904
7 SASI_Mm01_00040789 predicted 1385
8 SASI_Mm01_00040790 predicted 216
9 SASI_Mm02_00345848 predicted 868
10 SASI_Mm01_00040791 predicted 838
11 SASI_Mm01_00040783 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175187
VALIDATED
TMEM161B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 161B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175187.3-397s1c1
Sequence:CCGGGCACTGCATTACTTCCCAGAACTCGAGTTCTGGGAAGTAATGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175187.3-448s1c1
Sequence:CCGGGCTACCATTGTCTATTTAGTACTCGAGTACTAAATAGACAATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175187.3-1333s1c1
Sequence:CCGGCCCTTGCCAGTGGATAATAATCTCGAGATTATTATCCACTGGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175187.3-398s1c1
Sequence:CCGGCACTGCATTACTTCCCAGAATCTCGAGATTCTGGGAAGTAATGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175187
VALIDATED
TMEM161B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 161B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175187.3-397s1c1
Sequence:CCGGGCACTGCATTACTTCCCAGAACTCGAGTTCTGGGAAGTAATGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175187.3-448s1c1
Sequence:CCGGGCTACCATTGTCTATTTAGTACTCGAGTACTAAATAGACAATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175187.3-1333s1c1
Sequence:CCGGCCCTTGCCAGTGGATAATAATCTCGAGATTATTATCCACTGGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175187.3-398s1c1
Sequence:CCGGCACTGCATTACTTCCCAGAATCTCGAGATTCTGGGAAGTAATGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175187
VALIDATED
TMEM161B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 161B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175187.3-397s1c1
Sequence:CCGGGCACTGCATTACTTCCCAGAACTCGAGTTCTGGGAAGTAATGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175187.3-448s1c1
Sequence:CCGGGCTACCATTGTCTATTTAGTACTCGAGTACTAAATAGACAATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175187.3-1333s1c1
Sequence:CCGGCCCTTGCCAGTGGATAATAATCTCGAGATTATTATCCACTGGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175187.3-398s1c1
Sequence:CCGGCACTGCATTACTTCCCAGAATCTCGAGATTCTGGGAAGTAATGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153354
TMEM161B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 161B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000431162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153354.3-1363s21c1
Sequence:CCGGATAATAGTCTACTGTCCAATTCTCGAGAATTGGACAGTAGACTATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1608s21c1
Sequence:CCGGGCATATCCAAATCACCCTTTACTCGAGTAAAGGGTGATTTGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1843s21c1
Sequence:CCGGGGCTATCTACAAGGGTAATATCTCGAGATATTACCCTTGTAGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1951s21c1
Sequence:CCGGTGGTACTGTTGATAGTCATAGCTCGAGCTATGACTATCAACAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153354
TMEM161B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 161B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000431162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153354.3-1363s21c1
Sequence:CCGGATAATAGTCTACTGTCCAATTCTCGAGAATTGGACAGTAGACTATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1608s21c1
Sequence:CCGGGCATATCCAAATCACCCTTTACTCGAGTAAAGGGTGATTTGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1843s21c1
Sequence:CCGGGGCTATCTACAAGGGTAATATCTCGAGATATTACCCTTGTAGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1951s21c1
Sequence:CCGGTGGTACTGTTGATAGTCATAGCTCGAGCTATGACTATCAACAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153354
TMEM161B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 161B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000431162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153354.3-1363s21c1
Sequence:CCGGATAATAGTCTACTGTCCAATTCTCGAGAATTGGACAGTAGACTATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1608s21c1
Sequence:CCGGGCATATCCAAATCACCCTTTACTCGAGTAAAGGGTGATTTGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1843s21c1
Sequence:CCGGGGCTATCTACAAGGGTAATATCTCGAGATATTACCCTTGTAGATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153354.3-1951s21c1
Sequence:CCGGTGGTACTGTTGATAGTCATAGCTCGAGCTATGACTATCAACAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks