EMAIL THIS PAGE TO A FRIEND

TMEM163

transmembrane protein 163

Synonyms: DC29 SV31
UniProtKB ID: Q8TC26, Q53QM3, Q53SV7, Q69YH3, Q9UFG3
Gene ID:
Mouse(72160) transmembrane protein 163
Rat(360839) transmembrane protein 163
chicken(424287) transmembrane protein 163
domestic cat(101089455) transmembrane protein 163
dog(606939) transmembrane protein 163
naked mole-rat(101722815) transmembrane protein 163
domestic guinea pig(100712604) transmembrane protein 163
cow(534678) transmembrane protein 163
sheep(101116460) transmembrane protein 163
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030923 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028135 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028135 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028135 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030923 Rosetta Predictions human pricing
NM_001110763 Rosetta Predictions rat pricing
XM_341114 Rosetta Predictions rat pricing
NM_028135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119487 predicted 909
2 SASI_Hs02_00358474 predicted 510
3 SASI_Hs01_00119488 predicted 1113
4 SASI_Hs01_00119489 predicted 374
5 SASI_Hs02_00358475 predicted 374
6 SASI_Hs01_00119490 predicted 1202
7 SASI_Hs02_00358476 predicted 986
8 SASI_Hs01_00119492 predicted 765
9 SASI_Hs01_00119494 predicted 860
10 SASI_Hs01_00119495 predicted 539
11 SASI_Hs01_00119491 predicted 1135
12 SASI_Hs01_00119493 predicted 566
13 SASI_Hs01_00119496 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251312 predicted 658
2 SASI_Rn02_00251313 predicted 1449
3 SASI_Rn02_00251314 predicted 781
4 SASI_Rn02_00251315 predicted 568
5 SASI_Rn02_00251316 predicted 1233
6 SASI_Rn02_00251317 predicted 570
7 SASI_Rn02_00251318 predicted 948
8 SASI_Rn02_00251319 predicted 866
9 SASI_Rn02_00251320 predicted 1029
10 SASI_Rn02_00251321 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392391 predicted 735
2 SASI_Rn02_00392392 predicted 1525
3 SASI_Rn02_00392393 predicted 862
4 SASI_Rn02_00392394 predicted 647
5 SASI_Rn02_00392395 predicted 1307
6 SASI_Rn02_00392396 predicted 649
7 SASI_Rn02_00392397 predicted 1019
8 SASI_Rn02_00392398 predicted 933
9 SASI_Rn02_00392399 predicted 1101
10 SASI_Rn02_00392400 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197714 predicted 656
2 SASI_Mm01_00197716 predicted 786
3 SASI_Mm01_00197717 predicted 1456
4 SASI_Mm01_00197718 predicted 572
5 SASI_Mm01_00197719 predicted 913
6 SASI_Mm01_00197720 predicted 861
7 SASI_Mm01_00197721 predicted 1297
8 SASI_Mm01_00197722 predicted 1024
9 SASI_Mm01_00197723 predicted 1041
10 SASI_Mm02_00333404 predicted 1155
11 SASI_Mm01_00197715 predicted 1233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030923
TMEM163 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 163
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-841s21c1
Sequence:CCGGCTGATCGGCCTCACCATATTTCTCGAGAAATATGGTGAGGCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030923.4-1528s21c1
Sequence:CCGGAGCTTTGCATGGACGAATTAACTCGAGTTAATTCGTCCATGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-382s21c1
Sequence:CCGGGCCTTTACTGTCTCCGTTATGCTCGAGCATAACGGAGACAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-708s21c1
Sequence:CCGGGACCAGTAGAGCACTCATAACCTCGAGGTTATGAGTGCTCTACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-548s21c1
Sequence:CCGGTATTCCTTCTGTCATCCATATCTCGAGATATGGATGACAGAAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030923.2-785s1c1
Sequence:CCGGCGGAAGTGTTCAAGCATGACTCTCGAGAGTCATGCTTGAACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030923.2-584s1c1
Sequence:CCGGCCATCCATGACCTCTCAACTACTCGAGTAGTTGAGAGGTCATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167052    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030923.2-1396s1c1
Sequence:CCGGCATCAGTATGTCACTTCCTAACTCGAGTTAGGAAGTGACATACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030923
TMEM163 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 163
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-841s21c1
Sequence:CCGGCTGATCGGCCTCACCATATTTCTCGAGAAATATGGTGAGGCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030923.4-1528s21c1
Sequence:CCGGAGCTTTGCATGGACGAATTAACTCGAGTTAATTCGTCCATGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-382s21c1
Sequence:CCGGGCCTTTACTGTCTCCGTTATGCTCGAGCATAACGGAGACAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-708s21c1
Sequence:CCGGGACCAGTAGAGCACTCATAACCTCGAGGTTATGAGTGCTCTACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-548s21c1
Sequence:CCGGTATTCCTTCTGTCATCCATATCTCGAGATATGGATGACAGAAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030923.2-785s1c1
Sequence:CCGGCGGAAGTGTTCAAGCATGACTCTCGAGAGTCATGCTTGAACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030923.2-584s1c1
Sequence:CCGGCCATCCATGACCTCTCAACTACTCGAGTAGTTGAGAGGTCATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167052    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030923.2-1396s1c1
Sequence:CCGGCATCAGTATGTCACTTCCTAACTCGAGTTAGGAAGTGACATACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030923
TMEM163 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 163
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-841s21c1
Sequence:CCGGCTGATCGGCCTCACCATATTTCTCGAGAAATATGGTGAGGCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030923.4-1528s21c1
Sequence:CCGGAGCTTTGCATGGACGAATTAACTCGAGTTAATTCGTCCATGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-382s21c1
Sequence:CCGGGCCTTTACTGTCTCCGTTATGCTCGAGCATAACGGAGACAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-708s21c1
Sequence:CCGGGACCAGTAGAGCACTCATAACCTCGAGGTTATGAGTGCTCTACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030923.4-548s21c1
Sequence:CCGGTATTCCTTCTGTCATCCATATCTCGAGATATGGATGACAGAAGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030923.2-785s1c1
Sequence:CCGGCGGAAGTGTTCAAGCATGACTCTCGAGAGTCATGCTTGAACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030923.2-584s1c1
Sequence:CCGGCCATCCATGACCTCTCAACTACTCGAGTAGTTGAGAGGTCATGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167052    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030923.2-1396s1c1
Sequence:CCGGCATCAGTATGTCACTTCCTAACTCGAGTTAGGAAGTGACATACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028135
TMEM163 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 163
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-967s1c1
Sequence:CCGGCCATTCTAAGCGGGATCCTTTCTCGAGAAAGGATCCCGCTTAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028135.1-2045s1c1
Sequence:CCGGGCCCTCAGTTTATGTAACATTCTCGAGAATGTTACATAAACTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-1232s1c1
Sequence:CCGGGACGCGTCATTATGAAATGTTCTCGAGAACATTTCATAATGACGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-1097s1c1
Sequence:CCGGCCTTCTAAGTGCAGAAGTGTTCTCGAGAACACTTCTGCACTTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-668s1c1
Sequence:CCGGGCTGTCCATTATTGTCACCCTCTCGAGAGGGTGACAATAATGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028135
TMEM163 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 163
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-967s1c1
Sequence:CCGGCCATTCTAAGCGGGATCCTTTCTCGAGAAAGGATCCCGCTTAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028135.1-2045s1c1
Sequence:CCGGGCCCTCAGTTTATGTAACATTCTCGAGAATGTTACATAAACTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-1232s1c1
Sequence:CCGGGACGCGTCATTATGAAATGTTCTCGAGAACATTTCATAATGACGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-1097s1c1
Sequence:CCGGCCTTCTAAGTGCAGAAGTGTTCTCGAGAACACTTCTGCACTTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-668s1c1
Sequence:CCGGGCTGTCCATTATTGTCACCCTCTCGAGAGGGTGACAATAATGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028135
TMEM163 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 163
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-967s1c1
Sequence:CCGGCCATTCTAAGCGGGATCCTTTCTCGAGAAAGGATCCCGCTTAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028135.1-2045s1c1
Sequence:CCGGGCCCTCAGTTTATGTAACATTCTCGAGAATGTTACATAAACTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-1232s1c1
Sequence:CCGGGACGCGTCATTATGAAATGTTCTCGAGAACATTTCATAATGACGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-1097s1c1
Sequence:CCGGCCTTCTAAGTGCAGAAGTGTTCTCGAGAACACTTCTGCACTTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028135.1-668s1c1
Sequence:CCGGGCTGTCCATTATTGTCACCCTCTCGAGAGGGTGACAATAATGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks