EMAIL THIS PAGE TO A FRIEND

TMEM164

transmembrane protein 164

Synonyms: bB360B22.3
UniProtKB ID: Q5U3C3, B3KSQ8, F5H2P2
Gene ID:
Mouse(209497) transmembrane protein 164
Rat(367763) transmembrane protein 164
chicken(422344) transmembrane protein 164
domestic cat(101091178) transmembrane protein 164
dog(609227) transmembrane protein 164
cow(524183) transmembrane protein 164
sheep(101111164) transmembrane protein 164
domestic guinea pig(100722342) transmembrane protein 164
naked mole-rat(101716446) transmembrane protein 164
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038784 Anti-TMEM164 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032227 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032227 Rosetta Predictions human pricing
NM_001109014 Rosetta Predictions rat pricing
NM_177592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043859 predicted 322
2 SASI_Hs01_00043861 predicted 769
3 SASI_Hs01_00043862 predicted 649
4 SASI_Hs01_00043863 predicted 842
5 SASI_Hs01_00043864 predicted 633
6 SASI_Hs01_00043865 predicted 924
7 SASI_Hs01_00043866 predicted 944
8 SASI_Hs01_00043867 predicted 873
9 SASI_Hs01_00043868 predicted 975
10 SASI_Hs02_00359535 predicted 998
11 SASI_Hs01_00043860 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244324 predicted 341
2 SASI_Rn02_00244325 predicted 701
3 SASI_Rn02_00244326 predicted 600
4 SASI_Rn02_00244327 predicted 786
5 SASI_Rn02_00244328 predicted 895
6 SASI_Rn02_00244329 predicted 669
7 SASI_Rn02_00244330 predicted 648
8 SASI_Rn02_00244331 predicted 412
9 SASI_Rn02_00244332 predicted 759
10 SASI_Rn02_00244333 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101466 predicted 765
2 SASI_Mm01_00101468 predicted 830
3 SASI_Mm01_00101469 predicted 672
4 SASI_Mm01_00101470 predicted 778
5 SASI_Mm02_00347767 predicted 672
6 SASI_Mm01_00101471 predicted 851
7 SASI_Mm01_00101473 predicted 734
8 SASI_Mm02_00347768 predicted 724
9 SASI_Mm01_00101475 predicted 1747
10 SASI_Mm02_00347769 predicted 862
11 SASI_Mm01_00101467 predicted 421
12 SASI_Mm01_00101472 predicted 589
13 SASI_Mm01_00101474 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177592
VALIDATED
TMEM164 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 164
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-856s1c1
Sequence:CCGGGAGATTTACTACATCCAGCATCTCGAGATGCTGGATGTAGTAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-771s1c1
Sequence:CCGGCAAGTTACAGATGCACATGTTCTCGAGAACATGTGCATCTGTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-1294s1c1
Sequence:CCGGGAATGGAGTTTAGTCCTACATCTCGAGATGTAGGACTAAACTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-780s21c1
Sequence:CCGGCCTGGTCACCATGATGCATATCTCGAGATATGCATCATGGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-833s21c1
Sequence:CCGGCTACCGTCATCTTCAAGTTACCTCGAGGTAACTTGAAGATGACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-3377s21c1
Sequence:CCGGGTGCCAGCTCGGTAGGTATTTCTCGAGAAATACCTACCGAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-1092s21c1
Sequence:CCGGCCTGGTCACCGAAGTGAATTTCTCGAGAAATTCACTTCGGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177592
VALIDATED
TMEM164 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 164
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-856s1c1
Sequence:CCGGGAGATTTACTACATCCAGCATCTCGAGATGCTGGATGTAGTAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-771s1c1
Sequence:CCGGCAAGTTACAGATGCACATGTTCTCGAGAACATGTGCATCTGTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-1294s1c1
Sequence:CCGGGAATGGAGTTTAGTCCTACATCTCGAGATGTAGGACTAAACTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-780s21c1
Sequence:CCGGCCTGGTCACCATGATGCATATCTCGAGATATGCATCATGGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-833s21c1
Sequence:CCGGCTACCGTCATCTTCAAGTTACCTCGAGGTAACTTGAAGATGACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-3377s21c1
Sequence:CCGGGTGCCAGCTCGGTAGGTATTTCTCGAGAAATACCTACCGAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-1092s21c1
Sequence:CCGGCCTGGTCACCGAAGTGAATTTCTCGAGAAATTCACTTCGGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177592
VALIDATED
TMEM164 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 164
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-856s1c1
Sequence:CCGGGAGATTTACTACATCCAGCATCTCGAGATGCTGGATGTAGTAAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-771s1c1
Sequence:CCGGCAAGTTACAGATGCACATGTTCTCGAGAACATGTGCATCTGTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177592.2-1294s1c1
Sequence:CCGGGAATGGAGTTTAGTCCTACATCTCGAGATGTAGGACTAAACTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-780s21c1
Sequence:CCGGCCTGGTCACCATGATGCATATCTCGAGATATGCATCATGGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-833s21c1
Sequence:CCGGCTACCGTCATCTTCAAGTTACCTCGAGGTAACTTGAAGATGACGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-3377s21c1
Sequence:CCGGGTGCCAGCTCGGTAGGTATTTCTCGAGAAATACCTACCGAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177592.3-1092s21c1
Sequence:CCGGCCTGGTCACCGAAGTGAATTTCTCGAGAAATTCACTTCGGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032227
VALIDATED
TMEM164 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 164
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032227.1-2341s1c1
Sequence:CCGGGCTTCCCTTAGAACCAGTCTTCTCGAGAAGACTGGTTCTAAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032227.1-662s1c1
Sequence:CCGGGCTTTAAGTTCGCCACCAAGACTCGAGTCTTGGTGGCGAACTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032227.1-784s1c1
Sequence:CCGGCCCATCTACCTGCTTTGGAAACTCGAGTTTCCAAAGCAGGTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032227.1-606s1c1
Sequence:CCGGCCTGAGCAAGAATCTGCTCTTCTCGAGAAGAGCAGATTCTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032227.1-756s1c1
Sequence:CCGGCATTCAGCATGTTATGCTCTACTCGAGTAGAGCATAACATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-952s21c1
Sequence:CCGGCTCAACTGGCCTCATGTTCTTCTCGAGAAGAACATGAGGCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-642s21c1
Sequence:CCGGGCTTTAAGTTCGCCACCAAGACTCGAGTCTTGGTGGCGAACTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-881s21c1
Sequence:CCGGCCCATCTACCTGCTTTGGAAACTCGAGTTTCCAAAGCAGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-1011s21c1
Sequence:CCGGCCGAAGTGAATTTGAACAACACTCGAGTGTTGTTCAAATTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032227
VALIDATED
TMEM164 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 164
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032227.1-2341s1c1
Sequence:CCGGGCTTCCCTTAGAACCAGTCTTCTCGAGAAGACTGGTTCTAAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032227.1-662s1c1
Sequence:CCGGGCTTTAAGTTCGCCACCAAGACTCGAGTCTTGGTGGCGAACTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032227.1-784s1c1
Sequence:CCGGCCCATCTACCTGCTTTGGAAACTCGAGTTTCCAAAGCAGGTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032227.1-606s1c1
Sequence:CCGGCCTGAGCAAGAATCTGCTCTTCTCGAGAAGAGCAGATTCTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032227.1-756s1c1
Sequence:CCGGCATTCAGCATGTTATGCTCTACTCGAGTAGAGCATAACATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-952s21c1
Sequence:CCGGCTCAACTGGCCTCATGTTCTTCTCGAGAAGAACATGAGGCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-642s21c1
Sequence:CCGGGCTTTAAGTTCGCCACCAAGACTCGAGTCTTGGTGGCGAACTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-881s21c1
Sequence:CCGGCCCATCTACCTGCTTTGGAAACTCGAGTTTCCAAAGCAGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-1011s21c1
Sequence:CCGGCCGAAGTGAATTTGAACAACACTCGAGTGTTGTTCAAATTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032227
VALIDATED
TMEM164 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 164
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032227.1-2341s1c1
Sequence:CCGGGCTTCCCTTAGAACCAGTCTTCTCGAGAAGACTGGTTCTAAGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032227.1-662s1c1
Sequence:CCGGGCTTTAAGTTCGCCACCAAGACTCGAGTCTTGGTGGCGAACTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032227.1-784s1c1
Sequence:CCGGCCCATCTACCTGCTTTGGAAACTCGAGTTTCCAAAGCAGGTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032227.1-606s1c1
Sequence:CCGGCCTGAGCAAGAATCTGCTCTTCTCGAGAAGAGCAGATTCTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032227.1-756s1c1
Sequence:CCGGCATTCAGCATGTTATGCTCTACTCGAGTAGAGCATAACATGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-952s21c1
Sequence:CCGGCTCAACTGGCCTCATGTTCTTCTCGAGAAGAACATGAGGCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-642s21c1
Sequence:CCGGGCTTTAAGTTCGCCACCAAGACTCGAGTCTTGGTGGCGAACTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-881s21c1
Sequence:CCGGCCCATCTACCTGCTTTGGAAACTCGAGTTTCCAAAGCAGGTAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032227.2-1011s21c1
Sequence:CCGGCCGAAGTGAATTTGAACAACACTCGAGTGTTGTTCAAATTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks