EMAIL THIS PAGE TO A FRIEND

TMEM165

transmembrane protein 165

Synonyms: CDG2K FT27 GDT1 TMPT27 TPARL
UniProtKB ID: Q9HC07, A8K3P8, Q9BTN9, Q9NZ34
Gene ID:
Human(55858) Summary: This gene encodes a predicted transmembrane protein with a perinuclear Golgi-like distribution in fibroblasts. Mutations in this gene are associated with the autosomal recessive disorder congenital disorder of glycosylation, type IIk. Knockdown of this gene's expression causes decreased sialylation in HEK cells and suggests this gene plays a role in terminal Golgi glycosylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(21982) transmembrane protein 165
Rat(364137) transmembrane protein 165
naked mole-rat(101726152) transmembrane protein 165
domestic guinea pig(100727318) transmembrane protein 165
cow(532600) transmembrane protein 165
sheep(101107021) transmembrane protein 165
Zebrafish(324501) transmembrane protein 165
domestic cat(101088744) transmembrane protein 165
dog(475144) transmembrane protein 165
chicken(428780) transmembrane protein 165
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018475 Rosetta Predictions human pricing
NM_001024802 Rosetta Predictions rat pricing
NM_011626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202067 predicted 269
2 SASI_Hs01_00202068 predicted 715
3 SASI_Hs01_00202069 predicted 258
4 SASI_Hs02_00352051 predicted 882
5 SASI_Hs01_00202071 predicted 1017
6 SASI_Hs01_00202072 predicted 290
7 SASI_Hs01_00202073 predicted 344
8 SASI_Hs01_00202074 predicted 511
9 SASI_Hs02_00352052 predicted 477
10 SASI_Hs01_00202076 predicted 389
11 SASI_Hs01_00202070 predicted 244
12 SASI_Hs01_00202075 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104731 predicted 475
2 SASI_Rn01_00104732 predicted 491
3 SASI_Rn01_00104733 predicted 552
4 SASI_Rn01_00104736 predicted 1179
5 SASI_Rn01_00104737 predicted 1194
6 SASI_Rn01_00104738 predicted 1221
7 SASI_Rn01_00104739 predicted 497
8 SASI_Rn01_00104740 predicted 570
9 SASI_Rn02_00202727 predicted 718
10 SASI_Rn02_00202728 predicted 722
11 SASI_Rn01_00104734 predicted 931
12 SASI_Rn01_00104735 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094302 predicted 546
2 SASI_Mm02_00321071 predicted 613
3 SASI_Mm01_00094303 predicted 529
4 SASI_Mm01_00094304 predicted 1012
5 SASI_Mm01_00094305 predicted 557
6 SASI_Mm01_00094306 predicted 775
7 SASI_Mm01_00094307 predicted 778
8 SASI_Mm01_00094308 predicted 858
9 SASI_Mm01_00094309 predicted 877
10 SASI_Mm01_00094310 predicted 1095
11 SASI_Mm01_00094311 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011626
VALIDATED
TMEM165 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 165
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-1435s21c1
Sequence:CCGGTGGGTTCTCTCTAGCTTAATTCTCGAGAATTAAGCTAGAGAGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-973s21c1
Sequence:CCGGTTGTTCAAGCGCTCACATTAACTCGAGTTAATGTGAGCGCTTGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011626.2-878s21c1
Sequence:CCGGCCAACGAACCAAACTCTTAAACTCGAGTTTAAGAGTTTGGTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-839s21c1
Sequence:CCGGAGAAGTCCAAGCAGAGTTAAACTCGAGTTTAACTCTGCTTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-621s21c1
Sequence:CCGGATCATGGCGATGCGCTATAACCTCGAGGTTATAGCGCATCGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-1574s21c1
Sequence:CCGGGGGTTTAATGTATACCTTAAGCTCGAGCTTAAGGTATACATTAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011626.1-1402s1c1
Sequence:CCGGCCTCCACTTCTGCTTGATATACTCGAGTATATCAAGCAGAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-457s1c1
Sequence:CCGGCCCAGACGAATCTGGGATTTACTCGAGTAAATCCCAGATTCGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-809s1c1
Sequence:CCGGCCAACGAACCAAACTCTTAAACTCGAGTTTAAGAGTTTGGTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-948s1c1
Sequence:CCGGCGCTCTCAACTCACTACCATTCTCGAGAATGGTAGTGAGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-810s1c1
Sequence:CCGGCAACGAACCAAACTCTTAAATCTCGAGATTTAAGAGTTTGGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011626
VALIDATED
TMEM165 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 165
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-1435s21c1
Sequence:CCGGTGGGTTCTCTCTAGCTTAATTCTCGAGAATTAAGCTAGAGAGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-973s21c1
Sequence:CCGGTTGTTCAAGCGCTCACATTAACTCGAGTTAATGTGAGCGCTTGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011626.2-878s21c1
Sequence:CCGGCCAACGAACCAAACTCTTAAACTCGAGTTTAAGAGTTTGGTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-839s21c1
Sequence:CCGGAGAAGTCCAAGCAGAGTTAAACTCGAGTTTAACTCTGCTTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-621s21c1
Sequence:CCGGATCATGGCGATGCGCTATAACCTCGAGGTTATAGCGCATCGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-1574s21c1
Sequence:CCGGGGGTTTAATGTATACCTTAAGCTCGAGCTTAAGGTATACATTAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011626.1-1402s1c1
Sequence:CCGGCCTCCACTTCTGCTTGATATACTCGAGTATATCAAGCAGAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-457s1c1
Sequence:CCGGCCCAGACGAATCTGGGATTTACTCGAGTAAATCCCAGATTCGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-809s1c1
Sequence:CCGGCCAACGAACCAAACTCTTAAACTCGAGTTTAAGAGTTTGGTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-948s1c1
Sequence:CCGGCGCTCTCAACTCACTACCATTCTCGAGAATGGTAGTGAGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-810s1c1
Sequence:CCGGCAACGAACCAAACTCTTAAATCTCGAGATTTAAGAGTTTGGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011626
VALIDATED
TMEM165 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 165
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-1435s21c1
Sequence:CCGGTGGGTTCTCTCTAGCTTAATTCTCGAGAATTAAGCTAGAGAGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-973s21c1
Sequence:CCGGTTGTTCAAGCGCTCACATTAACTCGAGTTAATGTGAGCGCTTGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011626.2-878s21c1
Sequence:CCGGCCAACGAACCAAACTCTTAAACTCGAGTTTAAGAGTTTGGTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-839s21c1
Sequence:CCGGAGAAGTCCAAGCAGAGTTAAACTCGAGTTTAACTCTGCTTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-621s21c1
Sequence:CCGGATCATGGCGATGCGCTATAACCTCGAGGTTATAGCGCATCGCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011626.2-1574s21c1
Sequence:CCGGGGGTTTAATGTATACCTTAAGCTCGAGCTTAAGGTATACATTAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011626.1-1402s1c1
Sequence:CCGGCCTCCACTTCTGCTTGATATACTCGAGTATATCAAGCAGAAGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-457s1c1
Sequence:CCGGCCCAGACGAATCTGGGATTTACTCGAGTAAATCCCAGATTCGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-809s1c1
Sequence:CCGGCCAACGAACCAAACTCTTAAACTCGAGTTTAAGAGTTTGGTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-948s1c1
Sequence:CCGGCGCTCTCAACTCACTACCATTCTCGAGAATGGTAGTGAGTTGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011626.1-810s1c1
Sequence:CCGGCAACGAACCAAACTCTTAAATCTCGAGATTTAAGAGTTTGGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018475
VALIDATED
TMEM165 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 165
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018475.2-1164s1c1
Sequence:CCGGCTGACTTCTAAGTGTGGGTTTCTCGAGAAACCCACACTTAGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018475.2-408s1c1
Sequence:CCGGCTTGGGACTAATGACATGCTTCTCGAGAAGCATGTCATTAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018475.2-641s1c1
Sequence:CCGGGAGATGTTGAAACGGGTACAACTCGAGTTGTACCCGTTTCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018475.2-1404s1c1
Sequence:CCGGGAGCCAGTAAACAGTAGTTTACTCGAGTAAACTACTGTTTACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-845s1c1
Sequence:CCGGGATTGGCAGTAATTGGAGGAACTCGAGTTCCTCCAATTACTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-407s1c1
Sequence:CCGGCCTTGGGACTAATGACATGCTCTCGAGAGCATGTCATTAGTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018475.2-1163s1c1
Sequence:CCGGCCTGACTTCTAAGTGTGGGTTCTCGAGAACCCACACTTAGAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-522s1c1
Sequence:CCGGGCTTCGGGAAGGCTTAAAGATCTCGAGATCTTTAAGCCTTCCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018475
VALIDATED
TMEM165 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 165
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018475.2-1164s1c1
Sequence:CCGGCTGACTTCTAAGTGTGGGTTTCTCGAGAAACCCACACTTAGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018475.2-408s1c1
Sequence:CCGGCTTGGGACTAATGACATGCTTCTCGAGAAGCATGTCATTAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018475.2-641s1c1
Sequence:CCGGGAGATGTTGAAACGGGTACAACTCGAGTTGTACCCGTTTCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018475.2-1404s1c1
Sequence:CCGGGAGCCAGTAAACAGTAGTTTACTCGAGTAAACTACTGTTTACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-845s1c1
Sequence:CCGGGATTGGCAGTAATTGGAGGAACTCGAGTTCCTCCAATTACTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-407s1c1
Sequence:CCGGCCTTGGGACTAATGACATGCTCTCGAGAGCATGTCATTAGTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018475.2-1163s1c1
Sequence:CCGGCCTGACTTCTAAGTGTGGGTTCTCGAGAACCCACACTTAGAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-522s1c1
Sequence:CCGGGCTTCGGGAAGGCTTAAAGATCTCGAGATCTTTAAGCCTTCCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018475
VALIDATED
TMEM165 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 165
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018475.2-1164s1c1
Sequence:CCGGCTGACTTCTAAGTGTGGGTTTCTCGAGAAACCCACACTTAGAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018475.2-408s1c1
Sequence:CCGGCTTGGGACTAATGACATGCTTCTCGAGAAGCATGTCATTAGTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018475.2-641s1c1
Sequence:CCGGGAGATGTTGAAACGGGTACAACTCGAGTTGTACCCGTTTCAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018475.2-1404s1c1
Sequence:CCGGGAGCCAGTAAACAGTAGTTTACTCGAGTAAACTACTGTTTACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-845s1c1
Sequence:CCGGGATTGGCAGTAATTGGAGGAACTCGAGTTCCTCCAATTACTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-407s1c1
Sequence:CCGGCCTTGGGACTAATGACATGCTCTCGAGAGCATGTCATTAGTCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018475.2-1163s1c1
Sequence:CCGGCCTGACTTCTAAGTGTGGGTTCTCGAGAACCCACACTTAGAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018475.2-522s1c1
Sequence:CCGGGCTTCGGGAAGGCTTAAAGATCTCGAGATCTTTAAGCCTTCCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks