EMAIL THIS PAGE TO A FRIEND

TMEM167A

transmembrane protein 167A

Synonyms: TMEM167
UniProtKB ID: Q8TBQ9, Q0P692
Gene ID:
Rat(100359823) transmembrane protein 167A
cow(613669) transmembrane protein 167A
sheep(101102233) transmembrane protein 167A
domestic guinea pig(100728102) transmembrane protein 167A
naked mole-rat(101710284) transmembrane protein 167A
Zebrafish(541340) transmembrane protein 167A
chicken(770790) transmembrane protein 167A
dog(610083) protein kish-A-like
domestic cat(101092661) transmembrane protein 167A
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174909 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003681 MISSION® esiRNA esiRNA targeting human TMEM167A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174909 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243395 predicted 751
2 SASI_Hs01_00243396 predicted 679
3 SASI_Hs01_00243397 predicted 662
4 SASI_Hs01_00243398 predicted 667
5 SASI_Hs01_00243399 predicted 402
6 SASI_Hs01_00243400 predicted 676
7 SASI_Hs01_00243401 predicted 271
8 SASI_Hs01_00243402 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174909
VALIDATED
TMEM167A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 167A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-833s21c1
Sequence:CCGGGGTAAATGAGATGTAACTTAACTCGAGTTAAGTTACATCTCATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_174909.3-675s21c1
Sequence:CCGGGTGTTGATAAGGATTGCATTACTCGAGTAATGCAATCCTTATCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-925s21c1
Sequence:CCGGGAAACATCTTGTCAAGTATATCTCGAGATATACTTGACAAGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-805s21c1
Sequence:CCGGACAAGCTTATGCAGTTCTTAACTCGAGTTAAGAACTGCATAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_174909.3-760s21c1
Sequence:CCGGCTCTTAGCAAACTCTAGTTTACTCGAGTAAACTAGAGTTTGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174909.1-53s1c1
Sequence:CCGGGACTGTAATCTTGCTGCTTATCTCGAGATAAGCAGCAAGATTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174909
VALIDATED
TMEM167A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 167A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-833s21c1
Sequence:CCGGGGTAAATGAGATGTAACTTAACTCGAGTTAAGTTACATCTCATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_174909.3-675s21c1
Sequence:CCGGGTGTTGATAAGGATTGCATTACTCGAGTAATGCAATCCTTATCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-925s21c1
Sequence:CCGGGAAACATCTTGTCAAGTATATCTCGAGATATACTTGACAAGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-805s21c1
Sequence:CCGGACAAGCTTATGCAGTTCTTAACTCGAGTTAAGAACTGCATAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_174909.3-760s21c1
Sequence:CCGGCTCTTAGCAAACTCTAGTTTACTCGAGTAAACTAGAGTTTGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174909.1-53s1c1
Sequence:CCGGGACTGTAATCTTGCTGCTTATCTCGAGATAAGCAGCAAGATTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174909
VALIDATED
TMEM167A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 167A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-833s21c1
Sequence:CCGGGGTAAATGAGATGTAACTTAACTCGAGTTAAGTTACATCTCATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_174909.3-675s21c1
Sequence:CCGGGTGTTGATAAGGATTGCATTACTCGAGTAATGCAATCCTTATCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-925s21c1
Sequence:CCGGGAAACATCTTGTCAAGTATATCTCGAGATATACTTGACAAGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174909.3-805s21c1
Sequence:CCGGACAAGCTTATGCAGTTCTTAACTCGAGTTAAGAACTGCATAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_174909.3-760s21c1
Sequence:CCGGCTCTTAGCAAACTCTAGTTTACTCGAGTAAACTAGAGTTTGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174909.1-53s1c1
Sequence:CCGGGACTGTAATCTTGCTGCTTATCTCGAGATAAGCAGCAAGATTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks