EMAIL THIS PAGE TO A FRIEND

TMEM167B

transmembrane protein 167B

Synonyms: C1orf119
UniProtKB ID: Q9NRX6, B2RUU9
Gene ID:
Mouse(67495) transmembrane protein 167B
Rat(499690) transmembrane protein 167B
Zebrafish(445304) transmembrane protein 167B
chicken(771123) transmembrane protein 167B
dog(100688675) transmembrane protein 167B
domestic cat(101097330) transmembrane protein 167B
naked mole-rat(101723850) transmembrane protein 167B
domestic guinea pig(100728762) transmembrane protein 167B
cow(613426) transmembrane protein 167B
sheep(101102351) transmembrane protein 167B
207 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058971 MISSION® esiRNA esiRNA targeting mouse Tmem167b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020141 Rosetta Predictions human pricing
XM_001071753 Rosetta Predictions rat pricing
XM_575014 Rosetta Predictions rat pricing
NM_026198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238586 predicted 332
2 SASI_Hs01_00238587 predicted 268
3 SASI_Hs01_00238588 predicted 547
4 SASI_Hs02_00353028 predicted 463
5 SASI_Hs01_00238589 predicted 535
6 SASI_Hs01_00238590 predicted 251
7 SASI_Hs01_00238591 predicted 682
8 SASI_Hs01_00238592 predicted 271
9 SASI_Hs01_00238593 predicted 664
10 SASI_Hs01_00238594 predicted 743
11 SASI_Hs01_00238585 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336349 predicted 347
2 SASI_Rn02_00336350 predicted 760
3 SASI_Rn02_00336351 predicted 724
4 SASI_Rn02_00336352 predicted 477
5 SASI_Rn02_00336353 predicted 477
6 SASI_Rn02_00336354 predicted 257
7 SASI_Rn02_00336355 predicted 759
8 SASI_Rn02_00336356 predicted 638
9 SASI_Rn02_00336357 predicted 641
10 SASI_Rn02_00336358 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402900 predicted 878
2 SASI_Rn02_00402901 predicted 343
3 SASI_Rn02_00402902 predicted 761
4 SASI_Rn02_00402903 predicted 727
5 SASI_Rn02_00402904 predicted 636
6 SASI_Rn02_00402905 predicted 390
7 SASI_Rn02_00402906 predicted 483
8 SASI_Rn02_00402907 predicted 250
9 SASI_Rn02_00402908 predicted 862
10 SASI_Rn02_00402909 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099303 predicted 548
2 SASI_Mm01_00099304 predicted 333
3 SASI_Mm01_00099305 predicted 684
4 SASI_Mm01_00099306 predicted 297
5 SASI_Mm01_00099307 predicted 262
6 SASI_Mm01_00099308 predicted 392
7 SASI_Mm01_00099309 predicted 281
8 SASI_Mm01_00099310 predicted 466
9 SASI_Mm01_00099311 predicted 649
10 SASI_Mm01_00099312 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020141
TMEM167B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 167B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-273s1c1
Sequence:CCGGGCTGTGGCAATTGCTTGTGTTCTCGAGAACACAAGCAATTGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-160s1c1
Sequence:CCGGCCTGTGCCTACTTCAAGAAAGCTCGAGCTTTCTTGAAGTAGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020141.2-285s1c1
Sequence:CCGGGCTTGTGTTGTAATGGCCTTTCTCGAGAAAGGCCATTACAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-173s1c1
Sequence:CCGGCAAGAAAGTACCTCGTCTCAACTCGAGTTGAGACGAGGTACTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-142s1c1
Sequence:CCGGGTTTGCTCTTTGTTTGCACCTCTCGAGAGGTGCAAACAAAGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020141.2-279s1c1
Sequence:CCGGGCAATTGCTTGTGTTGTAATGCTCGAGCATTACAACACAAGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-204s1c1
Sequence:CCGGCTATCAGAGAAGAAGGGTGTTCTCGAGAACACCCTTCTTCTCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020141.3-241s21c1
Sequence:CCGGTGATTGGAACCAGGCTGCATGCTCGAGCATGCAGCCTGGTTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020141.3-469s21c1
Sequence:CCGGCTCATGGTCACGAACATTATTCTCGAGAATAATGTTCGTGACCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020141.3-544s21c1
Sequence:CCGGTCCTTGGCAGAGTGCATATAACTCGAGTTATATGCACTCTGCCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020141
TMEM167B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 167B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-273s1c1
Sequence:CCGGGCTGTGGCAATTGCTTGTGTTCTCGAGAACACAAGCAATTGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-160s1c1
Sequence:CCGGCCTGTGCCTACTTCAAGAAAGCTCGAGCTTTCTTGAAGTAGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020141.2-285s1c1
Sequence:CCGGGCTTGTGTTGTAATGGCCTTTCTCGAGAAAGGCCATTACAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-173s1c1
Sequence:CCGGCAAGAAAGTACCTCGTCTCAACTCGAGTTGAGACGAGGTACTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-142s1c1
Sequence:CCGGGTTTGCTCTTTGTTTGCACCTCTCGAGAGGTGCAAACAAAGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020141.2-279s1c1
Sequence:CCGGGCAATTGCTTGTGTTGTAATGCTCGAGCATTACAACACAAGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-204s1c1
Sequence:CCGGCTATCAGAGAAGAAGGGTGTTCTCGAGAACACCCTTCTTCTCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020141.3-241s21c1
Sequence:CCGGTGATTGGAACCAGGCTGCATGCTCGAGCATGCAGCCTGGTTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020141.3-469s21c1
Sequence:CCGGCTCATGGTCACGAACATTATTCTCGAGAATAATGTTCGTGACCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020141.3-544s21c1
Sequence:CCGGTCCTTGGCAGAGTGCATATAACTCGAGTTATATGCACTCTGCCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020141
TMEM167B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 167B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-273s1c1
Sequence:CCGGGCTGTGGCAATTGCTTGTGTTCTCGAGAACACAAGCAATTGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-160s1c1
Sequence:CCGGCCTGTGCCTACTTCAAGAAAGCTCGAGCTTTCTTGAAGTAGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020141.2-285s1c1
Sequence:CCGGGCTTGTGTTGTAATGGCCTTTCTCGAGAAAGGCCATTACAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-173s1c1
Sequence:CCGGCAAGAAAGTACCTCGTCTCAACTCGAGTTGAGACGAGGTACTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-142s1c1
Sequence:CCGGGTTTGCTCTTTGTTTGCACCTCTCGAGAGGTGCAAACAAAGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020141.2-279s1c1
Sequence:CCGGGCAATTGCTTGTGTTGTAATGCTCGAGCATTACAACACAAGCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020141.2-204s1c1
Sequence:CCGGCTATCAGAGAAGAAGGGTGTTCTCGAGAACACCCTTCTTCTCTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020141.3-241s21c1
Sequence:CCGGTGATTGGAACCAGGCTGCATGCTCGAGCATGCAGCCTGGTTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020141.3-469s21c1
Sequence:CCGGCTCATGGTCACGAACATTATTCTCGAGAATAATGTTCGTGACCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020141.3-544s21c1
Sequence:CCGGTCCTTGGCAGAGTGCATATAACTCGAGTTATATGCACTCTGCCAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026198
VALIDATED
TMEM167B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 167B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026198.1-274s1c1
Sequence:CCGGGTTGCAATTGCCTGCATTGTACTCGAGTACAATGCAGGCAATTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026198.1-2344s1c1
Sequence:CCGGCCCTTCTTAAACAGCTTTCATCTCGAGATGAAAGCTGTTTAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026198.1-168s1c1
Sequence:CCGGCTTCAAGAAAGTACCTCGTCTCTCGAGAGACGAGGTACTTTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-302s21c1
Sequence:CCGGTTTACGTCCTGTTTAACAAATCTCGAGATTTGTTAAACAGGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-693s21c1
Sequence:CCGGACCTACAGCTGGCCGTCTATTCTCGAGAATAGACGGCCAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-276s21c1
Sequence:CCGGTGCAATTGCCTGCATTGTAATCTCGAGATTACAATGCAGGCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-158s21c1
Sequence:CCGGCCTGTGCCTACTTCAAGAAAGCTCGAGCTTTCTTGAAGTAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-237s21c1
Sequence:CCGGCAAAGCTGCTGTGATTGGAACCTCGAGGTTCCAATCACAGCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026198
VALIDATED
TMEM167B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 167B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026198.1-274s1c1
Sequence:CCGGGTTGCAATTGCCTGCATTGTACTCGAGTACAATGCAGGCAATTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026198.1-2344s1c1
Sequence:CCGGCCCTTCTTAAACAGCTTTCATCTCGAGATGAAAGCTGTTTAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026198.1-168s1c1
Sequence:CCGGCTTCAAGAAAGTACCTCGTCTCTCGAGAGACGAGGTACTTTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-302s21c1
Sequence:CCGGTTTACGTCCTGTTTAACAAATCTCGAGATTTGTTAAACAGGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-693s21c1
Sequence:CCGGACCTACAGCTGGCCGTCTATTCTCGAGAATAGACGGCCAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-276s21c1
Sequence:CCGGTGCAATTGCCTGCATTGTAATCTCGAGATTACAATGCAGGCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-158s21c1
Sequence:CCGGCCTGTGCCTACTTCAAGAAAGCTCGAGCTTTCTTGAAGTAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-237s21c1
Sequence:CCGGCAAAGCTGCTGTGATTGGAACCTCGAGGTTCCAATCACAGCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026198
VALIDATED
TMEM167B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 167B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026198.1-274s1c1
Sequence:CCGGGTTGCAATTGCCTGCATTGTACTCGAGTACAATGCAGGCAATTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026198.1-2344s1c1
Sequence:CCGGCCCTTCTTAAACAGCTTTCATCTCGAGATGAAAGCTGTTTAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026198.1-168s1c1
Sequence:CCGGCTTCAAGAAAGTACCTCGTCTCTCGAGAGACGAGGTACTTTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-302s21c1
Sequence:CCGGTTTACGTCCTGTTTAACAAATCTCGAGATTTGTTAAACAGGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-693s21c1
Sequence:CCGGACCTACAGCTGGCCGTCTATTCTCGAGAATAGACGGCCAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-276s21c1
Sequence:CCGGTGCAATTGCCTGCATTGTAATCTCGAGATTACAATGCAGGCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-158s21c1
Sequence:CCGGCCTGTGCCTACTTCAAGAAAGCTCGAGCTTTCTTGAAGTAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026198.1-237s21c1
Sequence:CCGGCAAAGCTGCTGTGATTGGAACCTCGAGGTTCCAATCACAGCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks