EMAIL THIS PAGE TO A FRIEND

TMEM168

transmembrane protein 168

UniProtKB ID: Q9H0V1, A4D0T9, Q8NEK4, Q9H8J2
Gene ID:
Mouse(101118) transmembrane protein 168
Rat(312135) transmembrane protein 168
cow(541075) transmembrane protein 168
sheep(101112048) transmembrane protein 168
domestic guinea pig(100716476) transmembrane protein 168
naked mole-rat(101703000) transmembrane protein 168
chicken(417777) transmembrane protein 168
dog(611975) transmembrane protein 168
Horse(100055763) transmembrane protein 168
domestic cat(101083832) transmembrane protein 168
158 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022484 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022484 Rosetta Predictions human pricing
NM_001014054 Rosetta Predictions rat pricing
NM_028990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158186 predicted 984
2 SASI_Hs01_00158187 predicted 659
3 SASI_Hs01_00158189 predicted 2228
4 SASI_Hs01_00158190 predicted 1423
5 SASI_Hs01_00158191 predicted 1765
6 SASI_Hs02_00355768 predicted 2508
7 SASI_Hs01_00158193 predicted 951
8 SASI_Hs01_00158194 predicted 1584
9 SASI_Hs01_00158195 predicted 1697
10 SASI_Hs02_00355769 predicted 2256
11 SASI_Hs01_00158188 predicted 405
12 SASI_Hs01_00158192 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039872 predicted 335
2 SASI_Rn01_00039873 predicted 603
3 SASI_Rn01_00039874 predicted 925
4 SASI_Rn01_00039875 predicted 1136
5 SASI_Rn01_00039876 predicted 1700
6 SASI_Rn01_00039877 predicted 450
7 SASI_Rn01_00039878 predicted 595
8 SASI_Rn01_00039879 predicted 989
9 SASI_Rn02_00201447 predicted 2273
10 SASI_Rn01_00039880 predicted 426
11 SASI_Rn01_00039881 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110498 predicted 2454
2 SASI_Mm01_00110499 predicted 949
3 SASI_Mm01_00110500 predicted 374
4 SASI_Mm01_00110502 predicted 2461
5 SASI_Mm01_00110503 predicted 618
6 SASI_Mm01_00110504 predicted 1164
7 SASI_Mm01_00110505 predicted 2133
8 SASI_Mm01_00110506 predicted 1730
9 SASI_Mm01_00110507 predicted 1941
10 SASI_Mm02_00334721 predicted 462
11 SASI_Mm01_00110501 predicted 2536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028990
VALIDATED
TMEM168 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 168
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-2070s21c1
Sequence:CCGGGCGAAGACAGTAGATATTGAACTCGAGTTCAATATCTACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028990.3-2455s21c1
Sequence:CCGGGACATCAAGGAAGGCTATTATCTCGAGATAATAGCCTTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-1830s21c1
Sequence:CCGGGGACCTAGACATGATACATATCTCGAGATATGTATCATGTCTAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-586s21c1
Sequence:CCGGTCGCCAGCATACTCTACTATTCTCGAGAATAGTAGAGTATGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-1268s21c1
Sequence:CCGGCTGGATGATTTGCCATATTATCTCGAGATAATATGGCAAATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028990.2-496s1c1
Sequence:CCGGGCCATATGTTTAGGCCTTTATCTCGAGATAAAGGCCTAAACATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-3568s1c1
Sequence:CCGGCCTTCCAATTATCCTTACATTCTCGAGAATGTAAGGATAATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-2071s1c1
Sequence:CCGGGCGAAGACAGTAGATATTGAACTCGAGTTCAATATCTACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-933s1c1
Sequence:CCGGCGACCTGAGAATGAAGTCTTTCTCGAGAAAGACTTCATTCTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028990.2-625s1c1
Sequence:CCGGGCCAGTTTAAGTCTCTCCAATCTCGAGATTGGAGAGACTTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028990
VALIDATED
TMEM168 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 168
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-2070s21c1
Sequence:CCGGGCGAAGACAGTAGATATTGAACTCGAGTTCAATATCTACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028990.3-2455s21c1
Sequence:CCGGGACATCAAGGAAGGCTATTATCTCGAGATAATAGCCTTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-1830s21c1
Sequence:CCGGGGACCTAGACATGATACATATCTCGAGATATGTATCATGTCTAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-586s21c1
Sequence:CCGGTCGCCAGCATACTCTACTATTCTCGAGAATAGTAGAGTATGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-1268s21c1
Sequence:CCGGCTGGATGATTTGCCATATTATCTCGAGATAATATGGCAAATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028990.2-496s1c1
Sequence:CCGGGCCATATGTTTAGGCCTTTATCTCGAGATAAAGGCCTAAACATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-3568s1c1
Sequence:CCGGCCTTCCAATTATCCTTACATTCTCGAGAATGTAAGGATAATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-2071s1c1
Sequence:CCGGGCGAAGACAGTAGATATTGAACTCGAGTTCAATATCTACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-933s1c1
Sequence:CCGGCGACCTGAGAATGAAGTCTTTCTCGAGAAAGACTTCATTCTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028990.2-625s1c1
Sequence:CCGGGCCAGTTTAAGTCTCTCCAATCTCGAGATTGGAGAGACTTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028990
VALIDATED
TMEM168 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 168
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-2070s21c1
Sequence:CCGGGCGAAGACAGTAGATATTGAACTCGAGTTCAATATCTACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028990.3-2455s21c1
Sequence:CCGGGACATCAAGGAAGGCTATTATCTCGAGATAATAGCCTTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-1830s21c1
Sequence:CCGGGGACCTAGACATGATACATATCTCGAGATATGTATCATGTCTAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-586s21c1
Sequence:CCGGTCGCCAGCATACTCTACTATTCTCGAGAATAGTAGAGTATGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028990.3-1268s21c1
Sequence:CCGGCTGGATGATTTGCCATATTATCTCGAGATAATATGGCAAATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028990.2-496s1c1
Sequence:CCGGGCCATATGTTTAGGCCTTTATCTCGAGATAAAGGCCTAAACATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-3568s1c1
Sequence:CCGGCCTTCCAATTATCCTTACATTCTCGAGAATGTAAGGATAATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-2071s1c1
Sequence:CCGGGCGAAGACAGTAGATATTGAACTCGAGTTCAATATCTACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028990.2-933s1c1
Sequence:CCGGCGACCTGAGAATGAAGTCTTTCTCGAGAAAGACTTCATTCTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028990.2-625s1c1
Sequence:CCGGGCCAGTTTAAGTCTCTCCAATCTCGAGATTGGAGAGACTTAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022484
VALIDATED
TMEM168 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 168
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-2004s21c1
Sequence:CCGGTCCCGGCTTATTATCGTATTACTCGAGTAATACGATAATAAGCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-948s21c1
Sequence:CCGGGCTCTGGCTATGCTGATTATTCTCGAGAATAATCAGCATAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022484.4-1354s21c1
Sequence:CCGGCCAAATTAAATGACTGCCATACTCGAGTATGGCAGTCATTTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022484.4-2514s21c1
Sequence:CCGGAGCACTCATACTACCAATTATCTCGAGATAATTGGTAGTATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-621s21c1
Sequence:CCGGATCGCCAGCATACTCTATTACCTCGAGGTAATAGAGTATGCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-2865s1c1
Sequence:CCGGCCAGTTTACTTACAGAAGATTCTCGAGAATCTTCTGTAAGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-1326s1c1
Sequence:CCGGCCAAATTAAATGACTGCCATACTCGAGTATGGCAGTCATTTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-2436s1c1
Sequence:CCGGGCTTCAAACTTGTCAAATCTTCTCGAGAAGATTTGACAAGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-920s1c1
Sequence:CCGGGCTCTGGCTATGCTGATTATTCTCGAGAATAATCAGCATAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-1926s1c1
Sequence:CCGGGCCTTGACACACTTATAGAATCTCGAGATTCTATAAGTGTGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022484
VALIDATED
TMEM168 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 168
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-2004s21c1
Sequence:CCGGTCCCGGCTTATTATCGTATTACTCGAGTAATACGATAATAAGCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-948s21c1
Sequence:CCGGGCTCTGGCTATGCTGATTATTCTCGAGAATAATCAGCATAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022484.4-1354s21c1
Sequence:CCGGCCAAATTAAATGACTGCCATACTCGAGTATGGCAGTCATTTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022484.4-2514s21c1
Sequence:CCGGAGCACTCATACTACCAATTATCTCGAGATAATTGGTAGTATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-621s21c1
Sequence:CCGGATCGCCAGCATACTCTATTACCTCGAGGTAATAGAGTATGCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-2865s1c1
Sequence:CCGGCCAGTTTACTTACAGAAGATTCTCGAGAATCTTCTGTAAGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-1326s1c1
Sequence:CCGGCCAAATTAAATGACTGCCATACTCGAGTATGGCAGTCATTTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-2436s1c1
Sequence:CCGGGCTTCAAACTTGTCAAATCTTCTCGAGAAGATTTGACAAGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-920s1c1
Sequence:CCGGGCTCTGGCTATGCTGATTATTCTCGAGAATAATCAGCATAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-1926s1c1
Sequence:CCGGGCCTTGACACACTTATAGAATCTCGAGATTCTATAAGTGTGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022484
VALIDATED
TMEM168 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 168
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-2004s21c1
Sequence:CCGGTCCCGGCTTATTATCGTATTACTCGAGTAATACGATAATAAGCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-948s21c1
Sequence:CCGGGCTCTGGCTATGCTGATTATTCTCGAGAATAATCAGCATAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022484.4-1354s21c1
Sequence:CCGGCCAAATTAAATGACTGCCATACTCGAGTATGGCAGTCATTTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022484.4-2514s21c1
Sequence:CCGGAGCACTCATACTACCAATTATCTCGAGATAATTGGTAGTATGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022484.4-621s21c1
Sequence:CCGGATCGCCAGCATACTCTATTACCTCGAGGTAATAGAGTATGCTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-2865s1c1
Sequence:CCGGCCAGTTTACTTACAGAAGATTCTCGAGAATCTTCTGTAAGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-1326s1c1
Sequence:CCGGCCAAATTAAATGACTGCCATACTCGAGTATGGCAGTCATTTAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-2436s1c1
Sequence:CCGGGCTTCAAACTTGTCAAATCTTCTCGAGAAGATTTGACAAGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-920s1c1
Sequence:CCGGGCTCTGGCTATGCTGATTATTCTCGAGAATAATCAGCATAGCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_022484.3-1926s1c1
Sequence:CCGGGCCTTGACACACTTATAGAATCTCGAGATTCTATAAGTGTGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks