EMAIL THIS PAGE TO A FRIEND

TMEM169

transmembrane protein 169

UniProtKB ID: Q96HH4, B2R8W6
Gene ID:
Mouse(271711) transmembrane protein 169
Rat(690294) transmembrane protein 169
Zebrafish(558357) transmembrane protein 169
chicken(424223) transmembrane protein 169
domestic cat(101082507) transmembrane protein 169
dog(610243) transmembrane protein 169
naked mole-rat(101721330) transmembrane protein 169
domestic guinea pig(100725522) transmembrane protein 169
cow(617045) transmembrane protein 169
sheep(101106997) transmembrane protein 169
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138390 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119101 MISSION® esiRNA esiRNA human TMEM169 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138390 Rosetta Predictions human pricing
NM_001109574 Rosetta Predictions rat pricing
NM_175564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228762 predicted 429
2 SASI_Hs01_00228763 predicted 987
3 SASI_Hs02_00363530 predicted 963
4 SASI_Hs02_00363531 predicted 499
5 SASI_Hs01_00228765 predicted 517
6 SASI_Hs01_00228766 predicted 726
7 SASI_Hs01_00228767 predicted 598
8 SASI_Hs01_00228768 predicted 792
9 SASI_Hs01_00228770 predicted 611
10 SASI_Hs01_00228771 predicted 714
11 SASI_Hs01_00228764 predicted 771
12 SASI_Hs01_00228769 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249731 predicted 528
2 SASI_Rn02_00249732 predicted 1185
3 SASI_Rn02_00249733 predicted 493
4 SASI_Rn02_00249734 predicted 1009
5 SASI_Rn02_00249735 predicted 710
6 SASI_Rn02_00249736 predicted 1304
7 SASI_Rn02_00249737 predicted 911
8 SASI_Rn02_00249738 predicted 924
9 SASI_Rn02_00249739 predicted 522
10 SASI_Rn02_00249740 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133492 predicted 1151
2 SASI_Mm01_00133493 predicted 1132
3 SASI_Mm01_00133494 predicted 749
4 SASI_Mm02_00346548 predicted 1173
5 SASI_Mm01_00133496 predicted 396
6 SASI_Mm01_00133497 predicted 569
7 SASI_Mm01_00133498 predicted 1109
8 SASI_Mm01_00133499 predicted 1167
9 SASI_Mm01_00133500 predicted 385
10 SASI_Mm02_00346549 predicted 1180
11 SASI_Mm01_00133491 predicted 1059
12 SASI_Mm01_00133495 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138390
TMEM169 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 169
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-570s1c1
Sequence:CCGGGCAGGAACTGACCAAACCTAACTCGAGTTAGGTTTGGTCAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-999s1c1
Sequence:CCGGGTTGCTTGAATCCGACAATATCTCGAGATATTGTCGGATTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-433s1c1
Sequence:CCGGCTAGACTATCCTGTGGATGATCTCGAGATCATCCACAGGATAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-729s1c1
Sequence:CCGGCGGCACTATCACCTGGTACAACTCGAGTTGTACCAGGTGATAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138390.2-2436s1c1
Sequence:CCGGGCCTGAATCTTACACAGAGAACTCGAGTTCTCTGTGTAAGATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-391s1c1
Sequence:CCGGGAAGGTGGAGATCAGCCTAAACTCGAGTTTAGGCTGATCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138390.2-3104s1c1
Sequence:CCGGCCAGGACATTTGCCTGATGTACTCGAGTACATCAGGCAAATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-997s1c1
Sequence:CCGGGAGTTGCTTGAATCCGACAATCTCGAGATTGTCGGATTCAAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-1011s1c1
Sequence:CCGGCGACAATATCTCAAGCACTCTCTCGAGAGAGTGCTTGAGATATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-732s1c1
Sequence:CCGGCACTATCACCTGGTACAACATCTCGAGATGTTGTACCAGGTGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-436s1c1
Sequence:CCGGGACTATCCTGTGGATGATGATCTCGAGATCATCATCCACAGGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138390.2-2437s1c1
Sequence:CCGGCCTGAATCTTACACAGAGAATCTCGAGATTCTCTGTGTAAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138390
TMEM169 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 169
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-570s1c1
Sequence:CCGGGCAGGAACTGACCAAACCTAACTCGAGTTAGGTTTGGTCAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-999s1c1
Sequence:CCGGGTTGCTTGAATCCGACAATATCTCGAGATATTGTCGGATTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-433s1c1
Sequence:CCGGCTAGACTATCCTGTGGATGATCTCGAGATCATCCACAGGATAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-729s1c1
Sequence:CCGGCGGCACTATCACCTGGTACAACTCGAGTTGTACCAGGTGATAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138390.2-2436s1c1
Sequence:CCGGGCCTGAATCTTACACAGAGAACTCGAGTTCTCTGTGTAAGATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-391s1c1
Sequence:CCGGGAAGGTGGAGATCAGCCTAAACTCGAGTTTAGGCTGATCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138390.2-3104s1c1
Sequence:CCGGCCAGGACATTTGCCTGATGTACTCGAGTACATCAGGCAAATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-997s1c1
Sequence:CCGGGAGTTGCTTGAATCCGACAATCTCGAGATTGTCGGATTCAAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-1011s1c1
Sequence:CCGGCGACAATATCTCAAGCACTCTCTCGAGAGAGTGCTTGAGATATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-732s1c1
Sequence:CCGGCACTATCACCTGGTACAACATCTCGAGATGTTGTACCAGGTGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-436s1c1
Sequence:CCGGGACTATCCTGTGGATGATGATCTCGAGATCATCATCCACAGGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138390.2-2437s1c1
Sequence:CCGGCCTGAATCTTACACAGAGAATCTCGAGATTCTCTGTGTAAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138390
TMEM169 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 169
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-570s1c1
Sequence:CCGGGCAGGAACTGACCAAACCTAACTCGAGTTAGGTTTGGTCAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-999s1c1
Sequence:CCGGGTTGCTTGAATCCGACAATATCTCGAGATATTGTCGGATTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-433s1c1
Sequence:CCGGCTAGACTATCCTGTGGATGATCTCGAGATCATCCACAGGATAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-729s1c1
Sequence:CCGGCGGCACTATCACCTGGTACAACTCGAGTTGTACCAGGTGATAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138390.2-2436s1c1
Sequence:CCGGGCCTGAATCTTACACAGAGAACTCGAGTTCTCTGTGTAAGATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-391s1c1
Sequence:CCGGGAAGGTGGAGATCAGCCTAAACTCGAGTTTAGGCTGATCTCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138390.2-3104s1c1
Sequence:CCGGCCAGGACATTTGCCTGATGTACTCGAGTACATCAGGCAAATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-997s1c1
Sequence:CCGGGAGTTGCTTGAATCCGACAATCTCGAGATTGTCGGATTCAAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-1011s1c1
Sequence:CCGGCGACAATATCTCAAGCACTCTCTCGAGAGAGTGCTTGAGATATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138390.2-732s1c1
Sequence:CCGGCACTATCACCTGGTACAACATCTCGAGATGTTGTACCAGGTGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138390.2-436s1c1
Sequence:CCGGGACTATCCTGTGGATGATGATCTCGAGATCATCATCCACAGGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138390.2-2437s1c1
Sequence:CCGGCCTGAATCTTACACAGAGAATCTCGAGATTCTCTGTGTAAGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175564
TMEM169 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 169
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-402s1c1
Sequence:CCGGTCAGATAATGAGAAGACGGATCTCGAGATCCGTCTTCTCATTATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-756s1c1
Sequence:CCGGTCTTTCGTTGTGTCTTTCTATCTCGAGATAGAAAGACACAACGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-752s1c1
Sequence:CCGGGCTCTCTTTCGTTGTGTCTTTCTCGAGAAAGACACAACGAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-1059s1c1
Sequence:CCGGTCTGATAATATCTCGGGCAATCTCGAGATTGCCCGAGATATTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175564.2-1576s1c1
Sequence:CCGGGCACATAACTAAAGCCACAAACTCGAGTTTGTGGCTTTAGTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175564
TMEM169 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 169
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-402s1c1
Sequence:CCGGTCAGATAATGAGAAGACGGATCTCGAGATCCGTCTTCTCATTATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-756s1c1
Sequence:CCGGTCTTTCGTTGTGTCTTTCTATCTCGAGATAGAAAGACACAACGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-752s1c1
Sequence:CCGGGCTCTCTTTCGTTGTGTCTTTCTCGAGAAAGACACAACGAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-1059s1c1
Sequence:CCGGTCTGATAATATCTCGGGCAATCTCGAGATTGCCCGAGATATTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175564.2-1576s1c1
Sequence:CCGGGCACATAACTAAAGCCACAAACTCGAGTTTGTGGCTTTAGTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175564
TMEM169 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 169
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-402s1c1
Sequence:CCGGTCAGATAATGAGAAGACGGATCTCGAGATCCGTCTTCTCATTATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-756s1c1
Sequence:CCGGTCTTTCGTTGTGTCTTTCTATCTCGAGATAGAAAGACACAACGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-752s1c1
Sequence:CCGGGCTCTCTTTCGTTGTGTCTTTCTCGAGAAAGACACAACGAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175564.2-1059s1c1
Sequence:CCGGTCTGATAATATCTCGGGCAATCTCGAGATTGCCCGAGATATTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175564.2-1576s1c1
Sequence:CCGGGCACATAACTAAAGCCACAAACTCGAGTTTGTGGCTTTAGTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks