EMAIL THIS PAGE TO A FRIEND

TMEM170A

transmembrane protein 170A

Synonyms: TMEM170
UniProtKB ID: Q8WVE7, B2R4R3, B4DPS4, D3DUK2, Q7Z6F3
Gene ID:
Rat(498953) transmembrane protein 170A
cow(790244) transmembrane protein 170A
sheep(101117957) transmembrane protein 170A
domestic guinea pig(100733983) transmembrane protein 170A
naked mole-rat(101708387) transmembrane protein 170A
Zebrafish(393662) transmembrane protein 170A
chicken(770531) transmembrane protein 170A
domestic cat(101091672) transmembrane protein 170A
dog(612858) transmembrane protein 170A
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145254 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071461 MISSION® esiRNA esiRNA human TMEM170A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145254 Rosetta Predictions human pricing
NM_001134608 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201978 predicted 708
2 SASI_Hs01_00201979 predicted 517
3 SASI_Hs01_00201980 predicted 207
4 SASI_Hs02_00365107 predicted 355
5 SASI_Hs01_00201981 predicted 694
6 SASI_Hs01_00201982 predicted 681
7 SASI_Hs01_00201983 predicted 618
8 SASI_Hs01_00201984 predicted 595
9 SASI_Hs01_00201985 predicted 747
10 SASI_Hs01_00201986 predicted 512
11 SASI_Hs01_00201977 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257559 predicted 485
2 SASI_Rn02_00257560 predicted 865
3 SASI_Rn02_00257561 predicted 530
4 SASI_Rn02_00257562 predicted 421
5 SASI_Rn02_00257563 predicted 267
6 SASI_Rn02_00257564 predicted 314
7 SASI_Rn02_00257565 predicted 425
8 SASI_Rn02_00257566 predicted 602
9 SASI_Rn02_00257567 predicted 804
10 SASI_Rn02_00257568 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145254
VALIDATED
TMEM170A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 170A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145254.1-680s1c1
Sequence:CCGGGCTCCTAGAATTGAAGACTTACTCGAGTAAGTCTTCAATTCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_145254.1-880s1c1
Sequence:CCGGCGTGGAAGATACTGGTTTATTCTCGAGAATAAACCAGTATCTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145254.1-379s1c1
Sequence:CCGGGAATCTTGACAAGTGCAGCTACTCGAGTAGCTGCACTTGTCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145254.1-785s1c1
Sequence:CCGGCCTTTACCCAAGCCAAGTCAACTCGAGTTGACTTGGCTTGGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145254.1-296s1c1
Sequence:CCGGCTTCACCCTCAGACATCACAACTCGAGTTGTGATGTCTGAGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145254.1-823s21c1
Sequence:CCGGCATCCTTTGCACTGAAATTTACTCGAGTAAATTTCAGTGCAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145254.1-219s21c1
Sequence:CCGGGAGATGTGGTATGGTGTATTCCTCGAGGAATACACCATACCACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145254.1-354s21c1
Sequence:CCGGGGCATCGTGGGACCAATTACTCTCGAGAGTAATTGGTCCCACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145254
VALIDATED
TMEM170A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 170A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145254.1-680s1c1
Sequence:CCGGGCTCCTAGAATTGAAGACTTACTCGAGTAAGTCTTCAATTCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_145254.1-880s1c1
Sequence:CCGGCGTGGAAGATACTGGTTTATTCTCGAGAATAAACCAGTATCTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145254.1-379s1c1
Sequence:CCGGGAATCTTGACAAGTGCAGCTACTCGAGTAGCTGCACTTGTCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145254.1-785s1c1
Sequence:CCGGCCTTTACCCAAGCCAAGTCAACTCGAGTTGACTTGGCTTGGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145254.1-296s1c1
Sequence:CCGGCTTCACCCTCAGACATCACAACTCGAGTTGTGATGTCTGAGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145254.1-823s21c1
Sequence:CCGGCATCCTTTGCACTGAAATTTACTCGAGTAAATTTCAGTGCAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145254.1-219s21c1
Sequence:CCGGGAGATGTGGTATGGTGTATTCCTCGAGGAATACACCATACCACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145254.1-354s21c1
Sequence:CCGGGGCATCGTGGGACCAATTACTCTCGAGAGTAATTGGTCCCACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145254
VALIDATED
TMEM170A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 170A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145254.1-680s1c1
Sequence:CCGGGCTCCTAGAATTGAAGACTTACTCGAGTAAGTCTTCAATTCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_145254.1-880s1c1
Sequence:CCGGCGTGGAAGATACTGGTTTATTCTCGAGAATAAACCAGTATCTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145254.1-379s1c1
Sequence:CCGGGAATCTTGACAAGTGCAGCTACTCGAGTAGCTGCACTTGTCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145254.1-785s1c1
Sequence:CCGGCCTTTACCCAAGCCAAGTCAACTCGAGTTGACTTGGCTTGGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_145254.1-296s1c1
Sequence:CCGGCTTCACCCTCAGACATCACAACTCGAGTTGTGATGTCTGAGGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145254.1-823s21c1
Sequence:CCGGCATCCTTTGCACTGAAATTTACTCGAGTAAATTTCAGTGCAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145254.1-219s21c1
Sequence:CCGGGAGATGTGGTATGGTGTATTCCTCGAGGAATACACCATACCACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145254.1-354s21c1
Sequence:CCGGGGCATCGTGGGACCAATTACTCTCGAGAGTAATTGGTCCCACGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks