EMAIL THIS PAGE TO A FRIEND

TMEM170B

transmembrane protein 170B

UniProtKB ID: Q5T4T1
Gene ID:
Mouse(621976) transmembrane protein 170B
Rat(361230) transmembrane protein 170B
chicken(420857) transmembrane protein 170B
domestic cat(101091194) transmembrane protein 170B
dog(609876) transmembrane protein 170B
naked mole-rat(101697840) transmembrane protein 170B
domestic guinea pig(100724649) transmembrane protein 170B
cow(615389) transmembrane protein 170B
sheep(101116100) transmembrane protein 170B
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055134 Anti-TMEM170B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001100829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100829 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102481 MISSION® esiRNA esiRNA human TMEM170B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100829 Rosetta Predictions human pricing
XM_001061410 Rosetta Predictions rat pricing
XM_001075466 Rosetta Predictions rat pricing
XM_577563 Rosetta Predictions rat pricing
XM_886379 Rosetta Predictions mouse pricing
XM_913065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322397 predicted 460
2 SASI_Hs02_00322398 predicted 623
3 SASI_Hs02_00322399 predicted 231
4 SASI_Hs02_00322400 predicted 691
5 SASI_Hs02_00322401 predicted 432
6 SASI_Hs02_00322402 predicted 408
7 SASI_Hs02_00322403 predicted 693
8 SASI_Hs02_00322404 predicted 246
9 SASI_Hs02_00322405 predicted 354
10 SASI_Hs02_00322406 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299995 predicted 340
2 SASI_Rn02_00299996 predicted 612
3 SASI_Rn02_00299997 predicted 658
4 SASI_Rn02_00299998 predicted 479
5 SASI_Rn02_00299999 predicted 671
6 SASI_Rn02_00300000 predicted 609
7 SASI_Rn02_00300001 predicted 663
8 SASI_Rn02_00300002 predicted 426
9 SASI_Rn02_00300003 predicted 458
10 SASI_Rn02_00300004 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349844 predicted 336
2 SASI_Rn02_00349845 predicted 481
3 SASI_Rn02_00349846 predicted 463
4 SASI_Rn02_00349847 predicted 400
5 SASI_Rn02_00349848 predicted 428
6 SASI_Rn02_00349849 predicted 456
7 SASI_Rn02_00349850 predicted 387
8 SASI_Rn02_00349851 predicted 428
9 SASI_Rn02_00349852 predicted 421
10 SASI_Rn02_00349853 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137012 predicted 215
2 SASI_Rn01_00137013 predicted 317
3 SASI_Rn01_00137014 predicted 358
4 SASI_Rn01_00137015 predicted 425
5 SASI_Rn01_00137016 predicted 422
6 SASI_Rn01_00137017 predicted 329
7 SASI_Rn01_00137018 predicted 309
8 SASI_Rn01_00137019 predicted 244
9 SASI_Rn01_00137020 predicted 304
10 SASI_Rn01_00137021 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265806 predicted 371
2 SASI_Mm01_00265807 predicted 317
3 SASI_Mm01_00265809 predicted 362
4 SASI_Mm02_00428334 predicted 260
5 SASI_Mm01_00265810 predicted 255
6 SASI_Mm01_00265811 predicted 316
7 SASI_Mm01_00265812 predicted 506
8 SASI_Mm01_00265813 predicted 548
9 SASI_Mm01_00265814 predicted 557
10 SASI_Mm01_00265815 predicted 458
11 SASI_Mm01_00265808 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437442 predicted 372
2 SASI_Mm02_00437443 predicted 318
3 SASI_Mm02_00437444 predicted 358
4 SASI_Mm02_00437445 predicted 264
5 SASI_Mm02_00437446 predicted 249
6 SASI_Mm02_00437447 predicted 317
7 SASI_Mm02_00437448 predicted 513
8 SASI_Mm02_00437449 predicted 554
9 SASI_Mm02_00437450 predicted 553
10 SASI_Mm02_00437451 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163572
TMEM170B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 170B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000347733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163572.1-848s21c1
Sequence:CCGGGGCTTAGCTTTGTCGTGTTAACTCGAGTTAACACGACAAAGCTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-83s21c1
Sequence:CCGGTGAGGAACCTCACGGAGATGTCTCGAGACATCTCCGTGAGGTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-218s21c1
Sequence:CCGGTTGCTGTCAGCATCGGGTTTCCTCGAGGAAACCCGATGCTGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-245s21c1
Sequence:CCGGCTGTAACTGGAGCAATGATTACTCGAGTAATCATTGCTCCAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163572
TMEM170B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 170B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000347733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163572.1-848s21c1
Sequence:CCGGGGCTTAGCTTTGTCGTGTTAACTCGAGTTAACACGACAAAGCTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-83s21c1
Sequence:CCGGTGAGGAACCTCACGGAGATGTCTCGAGACATCTCCGTGAGGTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-218s21c1
Sequence:CCGGTTGCTGTCAGCATCGGGTTTCCTCGAGGAAACCCGATGCTGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-245s21c1
Sequence:CCGGCTGTAACTGGAGCAATGATTACTCGAGTAATCATTGCTCCAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163572
TMEM170B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 170B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000347733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163572.1-848s21c1
Sequence:CCGGGGCTTAGCTTTGTCGTGTTAACTCGAGTTAACACGACAAAGCTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-83s21c1
Sequence:CCGGTGAGGAACCTCACGGAGATGTCTCGAGACATCTCCGTGAGGTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-218s21c1
Sequence:CCGGTTGCTGTCAGCATCGGGTTTCCTCGAGGAAACCCGATGCTGACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163572.1-245s21c1
Sequence:CCGGCTGTAACTGGAGCAATGATTACTCGAGTAATCATTGCTCCAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100829
VALIDATED
TMEM170B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 170B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-245s21c1
Sequence:CCGGCTGTAACTGGAGCGATGATTACTCGAGTAATCATCGCTCCAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100829.1-3656s21c1
Sequence:CCGGGATATGAGCAACGGGATAATTCTCGAGAATTATCCCGTTGCTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001100829.1-386s21c1
Sequence:CCGGTCGCTACACTTTGAGGTTTCTCTCGAGAGAAACCTCAAAGTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-218s21c1
Sequence:CCGGTTGCAGTCAGCATTGGATTTCCTCGAGGAAATCCAATGCTGACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-345s21c1
Sequence:CCGGACAGACTGTACTGACATTAATCTCGAGATTAATGTCAGTACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100829
VALIDATED
TMEM170B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 170B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-245s21c1
Sequence:CCGGCTGTAACTGGAGCGATGATTACTCGAGTAATCATCGCTCCAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100829.1-3656s21c1
Sequence:CCGGGATATGAGCAACGGGATAATTCTCGAGAATTATCCCGTTGCTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001100829.1-386s21c1
Sequence:CCGGTCGCTACACTTTGAGGTTTCTCTCGAGAGAAACCTCAAAGTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-218s21c1
Sequence:CCGGTTGCAGTCAGCATTGGATTTCCTCGAGGAAATCCAATGCTGACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-345s21c1
Sequence:CCGGACAGACTGTACTGACATTAATCTCGAGATTAATGTCAGTACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100829
VALIDATED
TMEM170B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 170B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-245s21c1
Sequence:CCGGCTGTAACTGGAGCGATGATTACTCGAGTAATCATCGCTCCAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100829.1-3656s21c1
Sequence:CCGGGATATGAGCAACGGGATAATTCTCGAGAATTATCCCGTTGCTCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001100829.1-386s21c1
Sequence:CCGGTCGCTACACTTTGAGGTTTCTCTCGAGAGAAACCTCAAAGTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-218s21c1
Sequence:CCGGTTGCAGTCAGCATTGGATTTCCTCGAGGAAATCCAATGCTGACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100829.1-345s21c1
Sequence:CCGGACAGACTGTACTGACATTAATCTCGAGATTAATGTCAGTACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks