EMAIL THIS PAGE TO A FRIEND

TMEM171

transmembrane protein 171

Synonyms: PRP2
UniProtKB ID: Q8WVE6, Q8N0S1, Q8TDT7
Gene ID:
Mouse(380863) transmembrane protein 171
Rat(293634) transmembrane protein 171
cow(538802) transmembrane protein 171
sheep(101114643) transmembrane protein 171
domestic guinea pig(100735597) transmembrane protein 171
naked mole-rat(101715727) transmembrane protein 171
chicken(427220) transmembrane protein 171
domestic cat(101096947) transmembrane protein 171
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173490 Rosetta Predictions human pricing
NM_001013903 Rosetta Predictions rat pricing
NM_001025606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191626 predicted 758
2 SASI_Hs01_00191627 predicted 786
3 SASI_Hs01_00191628 predicted 626
4 SASI_Hs01_00191629 predicted 610
5 SASI_Hs01_00191630 predicted 239
6 SASI_Hs01_00191631 predicted 481
7 SASI_Hs01_00191632 predicted 711
8 SASI_Hs01_00191633 predicted 877
9 SASI_Hs01_00191634 predicted 605
10 SASI_Hs01_00191635 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083531 predicted 458
2 SASI_Rn01_00083532 predicted 518
3 SASI_Rn01_00083533 predicted 607
4 SASI_Rn02_00201187 predicted 262
5 SASI_Rn01_00083535 predicted 427
6 SASI_Rn01_00083536 predicted 438
7 SASI_Rn01_00083537 predicted 427
8 SASI_Rn02_00201188 predicted 372
9 SASI_Rn01_00083539 predicted 468
10 SASI_Rn01_00083540 predicted 459
11 SASI_Rn01_00083534 predicted 428
12 SASI_Rn01_00083538 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201060 predicted 505
2 SASI_Mm01_00201061 predicted 266
3 SASI_Mm01_00201062 predicted 651
4 SASI_Mm01_00201063 predicted 426
5 SASI_Mm01_00201064 predicted 260
6 SASI_Mm01_00201065 predicted 429
7 SASI_Mm01_00201066 predicted 429
8 SASI_Mm02_00287974 predicted 816
9 SASI_Mm01_00201068 predicted 231
10 SASI_Mm01_00201069 predicted 451
11 SASI_Mm01_00201067 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173490
VALIDATED
TMEM171 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 171
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173490.6-840s21c1
Sequence:CCGGTGTAGGTGACTCGGTAATAATCTCGAGATTATTACCGAGTCACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173490.6-801s21c1
Sequence:CCGGAGAGGGACAGATCCAGATTATCTCGAGATAATCTGGATCTGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173490.6-735s21c1
Sequence:CCGGCTTCGTGGTTGCCCATGTTAACTCGAGTTAACATGGGCAACCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173490.6-333s21c1
Sequence:CCGGGTTCCAGGCATGCCAATATAACTCGAGTTATATTGGCATGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-908s1c1
Sequence:CCGGCCTGGAACTAACAGTCTGCTTCTCGAGAAGCAGACTGTTAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-526s1c1
Sequence:CCGGCCTTATCTTTGGGTTTCTGTTCTCGAGAACAGAAACCCAAAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-654s1c1
Sequence:CCGGCCCGGATGTGTGGGTTCCTTTCTCGAGAAAGGAACCCACACATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-860s1c1
Sequence:CCGGCCACCACCTTACTTTCCTGAACTCGAGTTCAGGAAAGTAAGGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-1068s1c1
Sequence:CCGGCTCCACATCTTCCATCTGAATCTCGAGATTCAGATGGAAGATGTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173490
VALIDATED
TMEM171 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 171
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173490.6-840s21c1
Sequence:CCGGTGTAGGTGACTCGGTAATAATCTCGAGATTATTACCGAGTCACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173490.6-801s21c1
Sequence:CCGGAGAGGGACAGATCCAGATTATCTCGAGATAATCTGGATCTGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173490.6-735s21c1
Sequence:CCGGCTTCGTGGTTGCCCATGTTAACTCGAGTTAACATGGGCAACCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173490.6-333s21c1
Sequence:CCGGGTTCCAGGCATGCCAATATAACTCGAGTTATATTGGCATGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-908s1c1
Sequence:CCGGCCTGGAACTAACAGTCTGCTTCTCGAGAAGCAGACTGTTAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-526s1c1
Sequence:CCGGCCTTATCTTTGGGTTTCTGTTCTCGAGAACAGAAACCCAAAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-654s1c1
Sequence:CCGGCCCGGATGTGTGGGTTCCTTTCTCGAGAAAGGAACCCACACATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-860s1c1
Sequence:CCGGCCACCACCTTACTTTCCTGAACTCGAGTTCAGGAAAGTAAGGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-1068s1c1
Sequence:CCGGCTCCACATCTTCCATCTGAATCTCGAGATTCAGATGGAAGATGTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173490
VALIDATED
TMEM171 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 171
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173490.6-840s21c1
Sequence:CCGGTGTAGGTGACTCGGTAATAATCTCGAGATTATTACCGAGTCACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173490.6-801s21c1
Sequence:CCGGAGAGGGACAGATCCAGATTATCTCGAGATAATCTGGATCTGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173490.6-735s21c1
Sequence:CCGGCTTCGTGGTTGCCCATGTTAACTCGAGTTAACATGGGCAACCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173490.6-333s21c1
Sequence:CCGGGTTCCAGGCATGCCAATATAACTCGAGTTATATTGGCATGCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-908s1c1
Sequence:CCGGCCTGGAACTAACAGTCTGCTTCTCGAGAAGCAGACTGTTAGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-526s1c1
Sequence:CCGGCCTTATCTTTGGGTTTCTGTTCTCGAGAACAGAAACCCAAAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-654s1c1
Sequence:CCGGCCCGGATGTGTGGGTTCCTTTCTCGAGAAAGGAACCCACACATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-860s1c1
Sequence:CCGGCCACCACCTTACTTTCCTGAACTCGAGTTCAGGAAAGTAAGGTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173490.4-1068s1c1
Sequence:CCGGCTCCACATCTTCCATCTGAATCTCGAGATTCAGATGGAAGATGTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025606
VALIDATED
TMEM171 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 171
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-737s1c1
Sequence:CCGGGTAGGTGACTCAGTGATAATCCTCGAGGATTATCACTGAGTCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025606.1-232s21c1
Sequence:CCGGGTACCAGGCATGCCAATATAACTCGAGTTATATTGGCATGCCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-631s21c1
Sequence:CCGGCTTTGTGGTGGCCCATGTTAACTCGAGTTAACATGGGCCACCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025606.1-150s21c1
Sequence:CCGGGGCATGTCAGCAAGCTCATTTCTCGAGAAATGAGCTTGCTGACATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-914s21c1
Sequence:CCGGAGAGAACAGGAGCTCATATACCTCGAGGTATATGAGCTCCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-737s21c1
Sequence:CCGGGTAGGTGACTCAGTGATAATCCTCGAGGATTATCACTGAGTCACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-389s1c1
Sequence:CCGGCCTGACCAATCCTTCTTCTGTCTCGAGACAGAAGAAGGATTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-472s1c1
Sequence:CCGGGCTCATTAGCATACTGGGCATCTCGAGATGCCCAGTATGCTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-265s1c1
Sequence:CCGGCTGCAGCATAGTGCTGAAGATCTCGAGATCTTCAGCACTATGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025606
VALIDATED
TMEM171 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 171
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-737s1c1
Sequence:CCGGGTAGGTGACTCAGTGATAATCCTCGAGGATTATCACTGAGTCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025606.1-232s21c1
Sequence:CCGGGTACCAGGCATGCCAATATAACTCGAGTTATATTGGCATGCCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-631s21c1
Sequence:CCGGCTTTGTGGTGGCCCATGTTAACTCGAGTTAACATGGGCCACCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025606.1-150s21c1
Sequence:CCGGGGCATGTCAGCAAGCTCATTTCTCGAGAAATGAGCTTGCTGACATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-914s21c1
Sequence:CCGGAGAGAACAGGAGCTCATATACCTCGAGGTATATGAGCTCCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-737s21c1
Sequence:CCGGGTAGGTGACTCAGTGATAATCCTCGAGGATTATCACTGAGTCACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-389s1c1
Sequence:CCGGCCTGACCAATCCTTCTTCTGTCTCGAGACAGAAGAAGGATTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-472s1c1
Sequence:CCGGGCTCATTAGCATACTGGGCATCTCGAGATGCCCAGTATGCTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-265s1c1
Sequence:CCGGCTGCAGCATAGTGCTGAAGATCTCGAGATCTTCAGCACTATGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025606
VALIDATED
TMEM171 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 171
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-737s1c1
Sequence:CCGGGTAGGTGACTCAGTGATAATCCTCGAGGATTATCACTGAGTCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025606.1-232s21c1
Sequence:CCGGGTACCAGGCATGCCAATATAACTCGAGTTATATTGGCATGCCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-631s21c1
Sequence:CCGGCTTTGTGGTGGCCCATGTTAACTCGAGTTAACATGGGCCACCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025606.1-150s21c1
Sequence:CCGGGGCATGTCAGCAAGCTCATTTCTCGAGAAATGAGCTTGCTGACATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-914s21c1
Sequence:CCGGAGAGAACAGGAGCTCATATACCTCGAGGTATATGAGCTCCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025606.1-737s21c1
Sequence:CCGGGTAGGTGACTCAGTGATAATCCTCGAGGATTATCACTGAGTCACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-389s1c1
Sequence:CCGGCCTGACCAATCCTTCTTCTGTCTCGAGACAGAAGAAGGATTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-472s1c1
Sequence:CCGGGCTCATTAGCATACTGGGCATCTCGAGATGCCCAGTATGCTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025606.1-265s1c1
Sequence:CCGGCTGCAGCATAGTGCTGAAGATCTCGAGATCTTCAGCACTATGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks