EMAIL THIS PAGE TO A FRIEND

TMEM173

transmembrane protein 173

Synonyms: ERIS MITA MPYS NET23 STING
UniProtKB ID: Q86WV6, A8K3P6, B6EB35, D6RBX0, D6RE01, D6RID9
Gene ID:
Mouse(72512) transmembrane protein 173
Rat(498840) transmembrane protein 173
Zebrafish(101243556) transmembrane protein 173
domestic cat(101090737) transmembrane protein 173
dog(606815) transmembrane protein 173
chicken(768990) transmembrane protein 173
naked mole-rat(101722845) transmembrane protein 173
domestic guinea pig(100732510) transmembrane protein 173
cow(533661) transmembrane protein 173
sheep(101116050) transmembrane protein 173
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198282 Rosetta Predictions human pricing
NM_001109122 Rosetta Predictions rat pricing
XM_128954 Rosetta Predictions mouse pricing
XM_892499 Rosetta Predictions mouse pricing
XM_900116 Rosetta Predictions mouse pricing
XM_900126 Rosetta Predictions mouse pricing
XM_910347 Rosetta Predictions mouse pricing
XM_921603 Rosetta Predictions mouse pricing
XM_921606 Rosetta Predictions mouse pricing
XM_986235 Rosetta Predictions mouse pricing
XM_989707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371843 predicted 1175
2 SASI_Hs01_00031029 predicted 1081
3 SASI_Hs01_00031030 predicted 945
4 SASI_Hs01_00031031 predicted 974
5 SASI_Hs01_00031033 predicted 533
6 SASI_Hs01_00031034 predicted 1104
7 SASI_Hs01_00031035 predicted 365
8 SASI_Hs02_00371844 predicted 945
9 SASI_Hs01_00031036 predicted 961
10 SASI_Hs01_00031037 predicted 445
11 SASI_Hs01_00031032 predicted 910
12 SASI_Hs01_00031038 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245340 predicted 1733
2 SASI_Rn02_00245341 predicted 1437
3 SASI_Rn02_00245342 predicted 393
4 SASI_Rn02_00245343 predicted 1747
5 SASI_Rn02_00245344 predicted 1782
6 SASI_Rn02_00245345 predicted 1348
7 SASI_Rn02_00245346 predicted 1078
8 SASI_Rn02_00245347 predicted 941
9 SASI_Rn02_00245348 predicted 1078
10 SASI_Rn02_00245349 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424289 predicted 938
2 SASI_Mm02_00424290 predicted 510
3 SASI_Mm01_00211838 predicted 564
4 SASI_Mm02_00424291 predicted 1203
5 SASI_Mm02_00424292 predicted 811
6 SASI_Mm02_00424293 predicted 443
7 SASI_Mm02_00424294 predicted 762
8 SASI_Mm01_00211841 predicted 1184
9 SASI_Mm02_00424295 predicted 618
10 SASI_Mm02_00424296 predicted 1143
11 SASI_Mm01_00211837 predicted 857
12 SASI_Mm01_00211839 predicted 1654
13 SASI_Mm01_00211840 predicted 930
14 SASI_Mm01_00211842 predicted 1096
15 SASI_Mm01_00211843 predicted 1381
16 SASI_Mm01_00211844 predicted 731
17 SASI_Mm01_00211845 predicted 1169
18 SASI_Mm01_00211846 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00429135 predicted 916
2 SASI_Mm02_00429136 predicted 487
3 SASI_Mm01_00247170 predicted 544
4 SASI_Mm02_00429137 predicted 1179
5 SASI_Mm02_00429138 predicted 793
6 SASI_Mm02_00429139 predicted 420
7 SASI_Mm02_00429140 predicted 743
8 SASI_Mm01_00247172 predicted 1163
9 SASI_Mm02_00429141 predicted 598
10 SASI_Mm02_00429142 predicted 1120
11 SASI_Mm01_00247168 predicted 351
12 SASI_Mm01_00247169 predicted 834
13 SASI_Mm01_00247171 predicted 914
14 SASI_Mm01_00247173 predicted 1077
15 SASI_Mm01_00247174 predicted 1359
16 SASI_Mm01_00247175 predicted 703
17 SASI_Mm01_00247176 predicted 1156
18 SASI_Mm01_00247177 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242932 predicted 909
2 SASI_Mm01_00242933 predicted 621
3 SASI_Mm01_00242934 predicted 1694
4 SASI_Mm01_00242935 predicted 980
5 SASI_Mm01_00242936 predicted 1231
6 SASI_Mm01_00242937 predicted 1138
7 SASI_Mm01_00242938 predicted 1427
8 SASI_Mm01_00242939 predicted 778
9 SASI_Mm01_00242940 predicted 1217
10 SASI_Mm01_00242941 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430087 predicted 1045
2 SASI_Mm02_00430088 predicted 621
3 SASI_Mm01_00272742 predicted 665
4 SASI_Mm02_00430089 predicted 1305
5 SASI_Mm02_00430090 predicted 912
6 SASI_Mm02_00430091 predicted 540
7 SASI_Mm02_00430092 predicted 871
8 SASI_Mm01_00272745 predicted 1292
9 SASI_Mm02_00430093 predicted 720
10 SASI_Mm02_00430094 predicted 1250
11 SASI_Mm01_00272741 predicted 957
12 SASI_Mm01_00272743 predicted 1758
13 SASI_Mm01_00272744 predicted 1032
14 SASI_Mm01_00272746 predicted 1200
15 SASI_Mm01_00272747 predicted 1488
16 SASI_Mm01_00272748 predicted 835
17 SASI_Mm01_00272749 predicted 1279
18 SASI_Mm01_00272750 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435457 predicted 920
2 SASI_Mm02_00435458 predicted 346
3 SASI_Mm02_00435459 predicted 546
4 SASI_Mm02_00435460 predicted 1159
5 SASI_Mm02_00435461 predicted 329
6 SASI_Mm02_00435462 predicted 1125
7 SASI_Mm02_00435463 predicted 1359
8 SASI_Mm02_00435464 predicted 706
9 SASI_Mm02_00435465 predicted 1147
10 SASI_Mm02_00435466 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443165 predicted 1039
2 SASI_Mm02_00443166 predicted 467
3 SASI_Mm02_00443167 predicted 666
4 SASI_Mm02_00443168 predicted 1286
5 SASI_Mm02_00443169 predicted 452
6 SASI_Mm02_00443170 predicted 1245
7 SASI_Mm02_00443171 predicted 1482
8 SASI_Mm02_00443172 predicted 824
9 SASI_Mm02_00443173 predicted 1268
10 SASI_Mm02_00443174 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443185 predicted 941
2 SASI_Mm02_00443186 predicted 223
3 SASI_Mm02_00443187 predicted 526
4 SASI_Mm02_00443188 predicted 363
5 SASI_Mm02_00443189 predicted 1219
6 SASI_Mm02_00443190 predicted 569
7 SASI_Mm02_00443191 predicted 1186
8 SASI_Mm02_00443192 predicted 345
9 SASI_Mm02_00443193 predicted 1144
10 SASI_Mm02_00443194 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449030 predicted 918
2 SASI_Mm02_00449031 predicted 466
3 SASI_Mm02_00449032 predicted 1161
4 SASI_Mm02_00449033 predicted 452
5 SASI_Mm02_00449034 predicted 1124
6 SASI_Mm02_00449035 predicted 1356
7 SASI_Mm02_00449036 predicted 703
8 SASI_Mm02_00449037 predicted 1144
9 SASI_Mm02_00449038 predicted 493
10 SASI_Mm02_00449039 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450053 predicted 916
2 SASI_Mm02_00450054 predicted 933
3 SASI_Mm02_00450055 predicted 1392
4 SASI_Mm02_00450056 predicted 1293
5 SASI_Mm02_00450057 predicted 1182
6 SASI_Mm02_00450058 predicted 793
7 SASI_Mm01_00244252 predicted 1162
8 SASI_Mm02_00450059 predicted 1118
9 SASI_Mm02_00450060 predicted 1334
10 SASI_Mm01_00244254 predicted 1360
11 SASI_Mm01_00244247 predicted 1702
12 SASI_Mm01_00244248 predicted 1804
13 SASI_Mm01_00244249 predicted 837
14 SASI_Mm01_00244250 predicted 1626
15 SASI_Mm01_00244251 predicted 916
16 SASI_Mm01_00244253 predicted 1072
17 SASI_Mm01_00244255 predicted 1846
18 SASI_Mm01_00244256 predicted 1157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198282
TMEM173 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 173
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-901s1c1
Sequence:CCGGCCAACATTCGCTTCCTGGATACTCGAGTATCCAGGAAGCGAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198282.1-1472s1c1
Sequence:CCGGGCAGAGCTATTTCCTTCCACACTCGAGTGTGGAAGGAAATAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-780s1c1
Sequence:CCGGGCCCGGATTCGAACTTACAATCTCGAGATTGTAAGTTCGAATCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198282.1-1512s1c1
Sequence:CCGGGTCCAGGACTTGACATCTTAACTCGAGTTAAGATGTCAAGTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-729s1c1
Sequence:CCGGGCATGGTCATATTACATCGGACTCGAGTCCGATGTAATATGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-730s1c1
Sequence:CCGGCATGGTCATATTACATCGGATCTCGAGATCCGATGTAATATGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-725s1c1
Sequence:CCGGGCTGGCATGGTCATATTACATCTCGAGATGTAATATGACCATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-842s1c1
Sequence:CCGGGCTGTATATTCTCCTCCCATTCTCGAGAATGGGAGGAGAATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-966s1c1
Sequence:CCGGGTTTACAGCAACAGCATCTATCTCGAGATAGATGCTGTTGCTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198282
TMEM173 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 173
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-901s1c1
Sequence:CCGGCCAACATTCGCTTCCTGGATACTCGAGTATCCAGGAAGCGAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198282.1-1472s1c1
Sequence:CCGGGCAGAGCTATTTCCTTCCACACTCGAGTGTGGAAGGAAATAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-780s1c1
Sequence:CCGGGCCCGGATTCGAACTTACAATCTCGAGATTGTAAGTTCGAATCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198282.1-1512s1c1
Sequence:CCGGGTCCAGGACTTGACATCTTAACTCGAGTTAAGATGTCAAGTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-729s1c1
Sequence:CCGGGCATGGTCATATTACATCGGACTCGAGTCCGATGTAATATGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-730s1c1
Sequence:CCGGCATGGTCATATTACATCGGATCTCGAGATCCGATGTAATATGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-725s1c1
Sequence:CCGGGCTGGCATGGTCATATTACATCTCGAGATGTAATATGACCATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-842s1c1
Sequence:CCGGGCTGTATATTCTCCTCCCATTCTCGAGAATGGGAGGAGAATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-966s1c1
Sequence:CCGGGTTTACAGCAACAGCATCTATCTCGAGATAGATGCTGTTGCTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198282
TMEM173 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 173
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-901s1c1
Sequence:CCGGCCAACATTCGCTTCCTGGATACTCGAGTATCCAGGAAGCGAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163029    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198282.1-1472s1c1
Sequence:CCGGGCAGAGCTATTTCCTTCCACACTCGAGTGTGGAAGGAAATAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-780s1c1
Sequence:CCGGGCCCGGATTCGAACTTACAATCTCGAGATTGTAAGTTCGAATCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198282.1-1512s1c1
Sequence:CCGGGTCCAGGACTTGACATCTTAACTCGAGTTAAGATGTCAAGTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-729s1c1
Sequence:CCGGGCATGGTCATATTACATCGGACTCGAGTCCGATGTAATATGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-730s1c1
Sequence:CCGGCATGGTCATATTACATCGGATCTCGAGATCCGATGTAATATGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198282.1-725s1c1
Sequence:CCGGGCTGGCATGGTCATATTACATCTCGAGATGTAATATGACCATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-842s1c1
Sequence:CCGGGCTGTATATTCTCCTCCCATTCTCGAGAATGGGAGGAGAATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198282.1-966s1c1
Sequence:CCGGGTTTACAGCAACAGCATCTATCTCGAGATAGATGCTGTTGCTGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028261
VALIDATED
TMEM173 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 173
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-378s21c1
Sequence:CCGGAGAGGTCACCGCTCCAAATATCTCGAGATATTTGGAGCGGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028261.1-1970s21c1
Sequence:CCGGTTGTCTCTAGCACTGGTATTTCTCGAGAAATACCAGTGCTAGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-986s21c1
Sequence:CCGGCAACATTCGATTCCGAGATATCTCGAGATATCTCGGAATCGAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028261.1-1036s21c1
Sequence:CCGGGCATCAAGAATCGGGTTTATTCTCGAGAATAAACCCGATTCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-630s21c1
Sequence:CCGGATGATTCTACTATCGTCTTATCTCGAGATAAGACGATAGTAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028261
VALIDATED
TMEM173 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 173
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-378s21c1
Sequence:CCGGAGAGGTCACCGCTCCAAATATCTCGAGATATTTGGAGCGGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028261.1-1970s21c1
Sequence:CCGGTTGTCTCTAGCACTGGTATTTCTCGAGAAATACCAGTGCTAGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-986s21c1
Sequence:CCGGCAACATTCGATTCCGAGATATCTCGAGATATCTCGGAATCGAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028261.1-1036s21c1
Sequence:CCGGGCATCAAGAATCGGGTTTATTCTCGAGAATAAACCCGATTCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-630s21c1
Sequence:CCGGATGATTCTACTATCGTCTTATCTCGAGATAAGACGATAGTAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028261
VALIDATED
TMEM173 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 173
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-378s21c1
Sequence:CCGGAGAGGTCACCGCTCCAAATATCTCGAGATATTTGGAGCGGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028261.1-1970s21c1
Sequence:CCGGTTGTCTCTAGCACTGGTATTTCTCGAGAAATACCAGTGCTAGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-986s21c1
Sequence:CCGGCAACATTCGATTCCGAGATATCTCGAGATATCTCGGAATCGAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028261.1-1036s21c1
Sequence:CCGGGCATCAAGAATCGGGTTTATTCTCGAGAATAAACCCGATTCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028261.1-630s21c1
Sequence:CCGGATGATTCTACTATCGTCTTATCTCGAGATAAGACGATAGTAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks