EMAIL THIS PAGE TO A FRIEND

TMEM174

transmembrane protein 174

UniProtKB ID: Q8WUU8, B2RDA0, Q96N81
Gene ID:
Mouse(68344) transmembrane protein 174
Rat(499516) transmembrane protein 174
cow(618642) transmembrane protein 174
sheep(101114388) transmembrane protein 174
domestic guinea pig(100732712) transmembrane protein 174
naked mole-rat(101716509) transmembrane protein 174
Zebrafish(100005615) transmembrane protein 174
domestic cat(101092735) transmembrane protein 174
dog(610598) transmembrane protein 174
chicken(768886) transmembrane protein 174
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012691 MISSION® esiRNA esiRNA targeting human TMEM174 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153217 Rosetta Predictions human pricing
NM_001024298 Rosetta Predictions rat pricing
NM_026685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010561 predicted 843
2 SASI_Hs01_00010562 predicted 984
3 SASI_Hs01_00010563 predicted 833
4 SASI_Hs01_00010564 predicted 614
5 SASI_Hs01_00010565 predicted 821
6 SASI_Hs01_00010566 predicted 1020
7 SASI_Hs01_00010567 predicted 388
8 SASI_Hs01_00010568 predicted 949
9 SASI_Hs02_00367077 predicted 233
10 SASI_Hs02_00367078 predicted 852
11 SASI_Hs01_00010569 predicted 871
12 SASI_Hs01_00010570 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071498 predicted 1052
2 SASI_Rn01_00071499 predicted 990
3 SASI_Rn01_00071500 predicted 764
4 SASI_Rn01_00071502 predicted 997
5 SASI_Rn01_00071503 predicted 434
6 SASI_Rn01_00071504 predicted 974
7 SASI_Rn01_00071505 predicted 1095
8 SASI_Rn01_00071506 predicted 505
9 SASI_Rn02_00202491 predicted 568
10 SASI_Rn01_00071507 predicted 273
11 SASI_Rn01_00071501 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198084 predicted 574
2 SASI_Mm01_00198085 predicted 800
3 SASI_Mm01_00198086 predicted 195
4 SASI_Mm01_00198087 predicted 762
5 SASI_Mm01_00198088 predicted 289
6 SASI_Mm01_00198089 predicted 514
7 SASI_Mm01_00198090 predicted 604
8 SASI_Mm01_00198091 predicted 788
9 SASI_Mm01_00198092 predicted 584
10 SASI_Mm01_00198093 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153217
TMEM174 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 174
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153217.2-779s21c1
Sequence:CCGGAGAGGCTATTCTGATATAATACTCGAGTATTATATCAGAATAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153217.2-1139s21c1
Sequence:CCGGATCACGACTTCTGAGACTTTGCTCGAGCAAAGTCTCAGAAGTCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-860s1c1
Sequence:CCGGCCGTGGTGTTCTATGTTGTAACTCGAGTTACAACATAGAACACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-830s1c1
Sequence:CCGGGCAAGTGTTTCCGTCATTGTTCTCGAGAACAATGACGGAAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-1011s1c1
Sequence:CCGGGTTTCAAATTCCCTCGGGTAACTCGAGTTACCCGAGGGAATTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153217.1-347s1c1
Sequence:CCGGCCTGCCAGTTGTGCAAAGAAACTCGAGTTTCTTTGCACAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153217.1-763s1c1
Sequence:CCGGGAAGAAATATACTCTCTCCCTCTCGAGAGGGAGAGAGTATATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-954s1c1
Sequence:CCGGGCAATTTCTCAGATTGGTAAACTCGAGTTTACCAATCTGAGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153217
TMEM174 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 174
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153217.2-779s21c1
Sequence:CCGGAGAGGCTATTCTGATATAATACTCGAGTATTATATCAGAATAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153217.2-1139s21c1
Sequence:CCGGATCACGACTTCTGAGACTTTGCTCGAGCAAAGTCTCAGAAGTCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-860s1c1
Sequence:CCGGCCGTGGTGTTCTATGTTGTAACTCGAGTTACAACATAGAACACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-830s1c1
Sequence:CCGGGCAAGTGTTTCCGTCATTGTTCTCGAGAACAATGACGGAAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-1011s1c1
Sequence:CCGGGTTTCAAATTCCCTCGGGTAACTCGAGTTACCCGAGGGAATTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153217.1-347s1c1
Sequence:CCGGCCTGCCAGTTGTGCAAAGAAACTCGAGTTTCTTTGCACAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153217.1-763s1c1
Sequence:CCGGGAAGAAATATACTCTCTCCCTCTCGAGAGGGAGAGAGTATATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-954s1c1
Sequence:CCGGGCAATTTCTCAGATTGGTAAACTCGAGTTTACCAATCTGAGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153217
TMEM174 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 174
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153217.2-779s21c1
Sequence:CCGGAGAGGCTATTCTGATATAATACTCGAGTATTATATCAGAATAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153217.2-1139s21c1
Sequence:CCGGATCACGACTTCTGAGACTTTGCTCGAGCAAAGTCTCAGAAGTCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-860s1c1
Sequence:CCGGCCGTGGTGTTCTATGTTGTAACTCGAGTTACAACATAGAACACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-830s1c1
Sequence:CCGGGCAAGTGTTTCCGTCATTGTTCTCGAGAACAATGACGGAAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-1011s1c1
Sequence:CCGGGTTTCAAATTCCCTCGGGTAACTCGAGTTACCCGAGGGAATTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153217.1-347s1c1
Sequence:CCGGCCTGCCAGTTGTGCAAAGAAACTCGAGTTTCTTTGCACAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153217.1-763s1c1
Sequence:CCGGGAAGAAATATACTCTCTCCCTCTCGAGAGGGAGAGAGTATATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153217.1-954s1c1
Sequence:CCGGGCAATTTCTCAGATTGGTAAACTCGAGTTTACCAATCTGAGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026685
TMEM174 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 174
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-739s1c1
Sequence:CCGGCCGTATGAGGAGATATACGCTCTCGAGAGCGTATATCTCCTCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-76s1c1
Sequence:CCGGCTTAACGTGTTCTCTGTCACTCTCGAGAGTGACAGAGAACACGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-450s1c1
Sequence:CCGGGCAGTATATCCCTCCTCCTTACTCGAGTAAGGAGGAGGGATATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026685.1-833s1c1
Sequence:CCGGCGCTGTGTTCTTCAGAAGTTACTCGAGTAACTTCTGAAGAACACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026685
TMEM174 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 174
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-739s1c1
Sequence:CCGGCCGTATGAGGAGATATACGCTCTCGAGAGCGTATATCTCCTCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-76s1c1
Sequence:CCGGCTTAACGTGTTCTCTGTCACTCTCGAGAGTGACAGAGAACACGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-450s1c1
Sequence:CCGGGCAGTATATCCCTCCTCCTTACTCGAGTAAGGAGGAGGGATATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026685.1-833s1c1
Sequence:CCGGCGCTGTGTTCTTCAGAAGTTACTCGAGTAACTTCTGAAGAACACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026685
TMEM174 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 174
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-739s1c1
Sequence:CCGGCCGTATGAGGAGATATACGCTCTCGAGAGCGTATATCTCCTCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-76s1c1
Sequence:CCGGCTTAACGTGTTCTCTGTCACTCTCGAGAGTGACAGAGAACACGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026685.1-450s1c1
Sequence:CCGGGCAGTATATCCCTCCTCCTTACTCGAGTAAGGAGGAGGGATATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026685.1-833s1c1
Sequence:CCGGCGCTGTGTTCTTCAGAAGTTACTCGAGTAACTTCTGAAGAACACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks